WormBase Tree Display for Variation: WBVar02121770
expand all nodes | collapse all nodes | view schema
WBVar02121770 | Name | Public_name | WBVar02121770 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | cewivar00852693 | |||||||
Sequence_details | SMap | S_parent | Sequence | CHROMOSOME_IV | ||||
Flanking_sequences | CACAATCCACAAGTTTTTGCGCAATACTCC | ACCATATGAAAAACCGGCGAAAAATGGAAA | ||||||
Mapping_target | CHROMOSOME_IV | |||||||
Source_location | 225 | CHROMOSOME_IV | 4117001 | 4175000 | From_analysis | Million_mutation_project_reanalysis | ||
Type_of_mutation | Deletion | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Natural_variant | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00006629 | From_analysis | Million_mutation_project_reanalysis | |||||
Laboratory | VC | |||||||
Analysis | Million_mutation_project_reanalysis | |||||||
Status | Live | |||||||
Affects | Gene (31) | |||||||
Transcript (31) | ||||||||
Pseudogene | F49F1.8 | |||||||
F49F1.13 | ||||||||
K08D10.5 | ||||||||
R07C12.4 | ||||||||
F49F1.16 | ||||||||
K08D10.18 | ||||||||
R07C12.2 | ||||||||
K08D10.9 | ||||||||
Remark | The boundaries of this variant have been identified only approximately | |||||||
This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | ||||||||
Method | WGS_Flibotte |