WormBase Tree Display for Variation: WBVar02121545
expand all nodes | collapse all nodes | view schema
WBVar02121545 | Name | Public_name | WBVar02121545 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | cewivar00852468 | |||||||
Sequence_details | SMap | S_parent | Sequence | CHROMOSOME_II | ||||
Flanking_sequences | AAAAGTCGGCACATTGTGCCGATCGGCACT | CCTTAAGCCCAAGCCCGAGCCCGAGCCTAA | ||||||
Mapping_target | CHROMOSOME_II | |||||||
Source_location | 225 | CHROMOSOME_II | 3151001 | 3256000 | From_analysis | Million_mutation_project_reanalysis | ||
Type_of_mutation | Deletion | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Natural_variant | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00006625 | From_analysis | Million_mutation_project_reanalysis | |||||
Laboratory | VC | |||||||
Analysis | Million_mutation_project_reanalysis | |||||||
Status | Live | |||||||
Affects | Gene (48) | |||||||
Transcript (49) | ||||||||
Pseudogene | ZC239.1 | |||||||
C17F4.9 | ||||||||
Y27F2A.1 | ||||||||
ZC239.2 | ||||||||
Remark | The boundaries of this variant have been identified only approximately | |||||||
This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | ||||||||
Method | WGS_Flibotte |