WormBase Tree Display for Variation: WBVar02120739
expand all nodes | collapse all nodes | view schema
WBVar02120739 | Name | Public_name | WBVar02120739 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | cewivar00851662 | |||||||
Sequence_details | SMap | S_parent | Sequence | T26C11 | ||||
Flanking_sequences | TTACATCCCTACGGATCTATTGAAAAATAG | ATTAATAAAATCTAAGTCCTAAGCCGCTTT | ||||||
Mapping_target | T26C11 | |||||||
Source_location | 225 | CHROMOSOME_X | 1840001 | 1856000 | From_analysis | Million_mutation_project_reanalysis | ||
Type_of_mutation | Deletion | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Natural_variant | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00000034 | From_analysis | Million_mutation_project_reanalysis | |||||
Laboratory | VC | |||||||
Analysis | Million_mutation_project_reanalysis | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00000460 | ||||||
WBGene00194679 | ||||||||
WBGene00020830 | ||||||||
WBGene00000444 | ||||||||
WBGene00000462 | ||||||||
Transcript | T26C11.7.1 | |||||||
T26C11.9.2 | ||||||||
T26C11.4a.1 | ||||||||
T26C11.9.1 | ||||||||
T26C11.5.1 | ||||||||
T26C11.6.1 | ||||||||
T26C11.4b.1 | ||||||||
Remark | The boundaries of this variant have been identified only approximately | |||||||
This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | ||||||||
Method | WGS_Flibotte |