WormBase Tree Display for Variation: WBVar02120583
expand all nodes | collapse all nodes | view schema
WBVar02120583 | Name | Public_name | WBVar02120583 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | cewivar00851506 | |||||||
Sequence_details | SMap | S_parent | Sequence | CHROMOSOME_I | ||||
Flanking_sequences | GTTTGTGTGATGCTCCATTTTTCTTCTGAT | AATTTCCCTTATTCCCCCAAAAATTTCTAC | ||||||
Mapping_target | CHROMOSOME_I | |||||||
Source_location | 225 | CHROMOSOME_I | 13077001 | 13106000 | From_analysis | Million_mutation_project_reanalysis | ||
Type_of_mutation | Tandem_duplication | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Natural_variant | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00000034 | From_analysis | Million_mutation_project_reanalysis | |||||
Laboratory | VC | |||||||
Analysis | Million_mutation_project_reanalysis | |||||||
Status | Live | |||||||
Affects | Gene (15) | |||||||
Transcript (12) | ||||||||
Pseudogene | Y26D4A.19a | |||||||
Y26D4A.22b | ||||||||
Y26D4A.18b | ||||||||
Y26D4A.19b | ||||||||
Y26D4A.22a | ||||||||
Y26D4A.18a | ||||||||
Remark | The boundaries of this variant have been identified only approximately | |||||||
This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | ||||||||
Method | WGS_Flibotte |