WormBase Tree Display for Variation: WBVar01473861
expand all nodes | collapse all nodes | view schema
WBVar01473861 | Name | Public_name | tm6127 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | T25D10.2.1:c.410_502-121del | |||||||
HGVSg | CHROMOSOME_II:g.6399950_6400173del | |||||||
Sequence_details | SMap | S_parent | Sequence | T25D10 | ||||
Flanking_sequences | atgaaatatcacaaaatgaaaaaataaagt | atttccaaaaacctaaaaaagtaatcataa | ||||||
Mapping_target | T25D10 | |||||||
Source_location | 7 | CHROMOSOME_II | 6399949 | 6400174 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm6127_external | |||||||
tm6127_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 6127 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00020800 | ||||||
Transcript | T25D10.2.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | T25D10.2.1:c.410_502-121del | |||||||
cDNA_position | 413-? | |||||||
CDS_position | 410-? | |||||||
Protein_position | 137-? | |||||||
Intron_number | 3/5 | |||||||
Exon_number | 3/6 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | II | ||||||
Description | Phenotype | WBPhenotype:0000643 | Paper_evidence | WBPaper00049101 | ||||
Curator_confirmed | WBPerson28441 | |||||||
Remark | Figure 1F, tm6127; n2420 animals displayed increased convulsion frequency compared to n2420 single mutants. | Paper_evidence | WBPaper00049101 | |||||
Curator_confirmed | WBPerson28441 | |||||||
Phenotype_assay | Genotype | acr-2(n2420) | Paper_evidence | WBPaper00049101 | ||||
Curator_confirmed | WBPerson28441 | |||||||
WBPhenotype:0001701 | Paper_evidence | WBPaper00049101 | ||||||
Curator_confirmed | WBPerson28441 | |||||||
Remark | Figure 1F, tm6127; n2420 animals displayed increased convulsion frequency compared to n2420 single mutants. | Paper_evidence | WBPaper00049101 | |||||
Curator_confirmed | WBPerson28441 | |||||||
Phenotype_assay | Genotype | acr-2(n2420) | Paper_evidence | WBPaper00049101 | ||||
Curator_confirmed | WBPerson28441 | |||||||
WBPhenotype:0002001 | Paper_evidence | WBPaper00049101 | ||||||
Curator_confirmed | WBPerson28441 | |||||||
Remark | Increased UNC-10 stained synapses in Figure 3A-B, increased cholinergic synapses in Figure 4A-B, 5B, and 8B. | Paper_evidence | WBPaper00049101 | |||||
Curator_confirmed | WBPerson28441 | |||||||
Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0002001 | Paper_evidence | WBPaper00049101 | ||||||
Curator_confirmed | WBPerson28441 | |||||||
Remark | No observed changes in GABAergic synapse number in Figure 4C-D | Paper_evidence | WBPaper00049101 | |||||
Curator_confirmed | WBPerson28441 | |||||||
Reference | WBPaper00049101 | |||||||
Remark | 3666/3667-3890/3891 (224 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |