WormBase Tree Display for Variation: WBVar00604218
expand all nodes | collapse all nodes | view schema
| WBVar00604218 | Name | Public_name | dotSi100 | ||
|---|---|---|---|---|---|
| Sequence_details | Flanking_sequences | ATTCCATGATGGTAGCAAACTCACTTCGTG | TAAGTGCAAGTAAGATCAGTGTTTGTTTCG | ||
| Mapping_target | F14E5 | ||||
| Type_of_mutation | Insertion | ||||
| SeqStatus | Sequenced | ||||
| Variation_type | Allele | ||||
| Origin | Species | Caenorhabditis elegans | |||
| Strain | WBStrain00022705 | ||||
| Laboratory | JNC | ||||
| Status | Dead | Curator_confirmed | WBPerson1983 | ||
| Remark | dotSi100 is a cyb-3 duplication that was inserted into the ttTi5605 mos insertion site on chromosome II between the F14E5.1 and the F14E5.2 genes | ||||
| Removed dotSi100 as a variation as this is a transgene ID; Created incorrectly during the automatic Strain import from the CGC as well some manually from publications. | |||||
| Method | Insertion_allele |
