WormBase Tree Display for Variation: WBVar00603895
expand all nodes | collapse all nodes | view schema
WBVar00603895 | Evidence | Paper_evidence | WBPaper00040002 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | iv38 | |||||||
Other_name (12) | |||||||||
HGVSg | CHROMOSOME_V:g.11907714_11907715delinsAA | ||||||||
Sequence_details | SMap | S_parent | Sequence | R31 | |||||
Flanking_sequences | aagctaaaagctctgaacttgaaacagctt | agtgaattgaagaagcttctacgcttgaga | |||||||
Mapping_target | R31 | ||||||||
Type_of_mutation | Substitution | gg | rr | Paper_evidence | WBPaper00040002 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | GD | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00004855 | |||||||
Transcript | R31.1e.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | R31.1e.1:c.5252_5253delinsAA | ||||||||
HGVSp | CE52987:p.Trp1751Ter | ||||||||
cDNA_position | 5252-5253 | ||||||||
CDS_position | 5252-5253 | ||||||||
Protein_position | 1751 | ||||||||
Exon_number | 8/17 | ||||||||
Codon_change | tGG/tAA | ||||||||
Amino_acid_change | W/* | ||||||||
R31.1a.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | R31.1a.1:c.5252_5253delinsAA | ||||||||
HGVSp | CE41581:p.Trp1751Ter | ||||||||
cDNA_position | 5367-5368 | ||||||||
CDS_position | 5252-5253 | ||||||||
Protein_position | 1751 | ||||||||
Exon_number | 9/20 | ||||||||
Codon_change | tGG/tAA | ||||||||
Amino_acid_change | W/* | ||||||||
R31.1c.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | R31.1c.1:c.4694_4695delinsAA | ||||||||
HGVSp | CE46009:p.Trp1565Ter | ||||||||
cDNA_position | 4694-4695 | ||||||||
CDS_position | 4694-4695 | ||||||||
Protein_position | 1565 | ||||||||
Exon_number | 5/15 | ||||||||
Codon_change | tGG/tAA | ||||||||
Amino_acid_change | W/* | ||||||||
R31.1b.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | R31.1b.1:c.4943_4944delinsAA | ||||||||
HGVSp | CE27773:p.Trp1648Ter | ||||||||
cDNA_position | 4943-4944 | ||||||||
CDS_position | 4943-4944 | ||||||||
Protein_position | 1648 | ||||||||
Exon_number | 7/17 | ||||||||
Codon_change | tGG/tAA | ||||||||
Amino_acid_change | W/* | ||||||||
R31.1d.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | R31.1d.1:c.4943_4944delinsAA | ||||||||
HGVSp | CE46252:p.Trp1648Ter | ||||||||
cDNA_position | 5185-5186 | ||||||||
CDS_position | 4943-4944 | ||||||||
Protein_position | 1648 | ||||||||
Exon_number | 8/18 | ||||||||
Codon_change | tGG/tAA | ||||||||
Amino_acid_change | W/* | ||||||||
R31.1f.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | R31.1f.1:c.4694_4695delinsAA | ||||||||
HGVSp | CE53064:p.Trp1565Ter | ||||||||
cDNA_position | 4694-4695 | ||||||||
CDS_position | 4694-4695 | ||||||||
Protein_position | 1565 | ||||||||
Exon_number | 5/14 | ||||||||
Codon_change | tGG/tAA | ||||||||
Amino_acid_change | W/* | ||||||||
Genetics | Interpolated_map_position | V | 3.53953 | ||||||
Description | Phenotype | WBPhenotype:0000229 | Paper_evidence | WBPaper00040002 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | iv38 homozygotes are smaller (Sma) than wild-typeanimals of the same developmental stage | Paper_evidence | WBPaper00040002 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000583 | Paper_evidence | WBPaper00040002 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | iv38 homozygotes are somewhat dumpy (Dpy) in appearance. | Paper_evidence | WBPaper00040002 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000709 | Paper_evidence | WBPaper00040002 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | mean pharynx length is significantly smaller than that of N2 | Paper_evidence | WBPaper00040002 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0003681 | PATO:0000460 | Paper_evidence | WBPaper00040002 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00040002 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000901 | Paper_evidence | WBPaper00040002 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | animals had abnormal morphology of the gland extensions; iv38 have normal gland cell bodies and all glands appear to connect with the pharyngeal lumen at their normal positions. However, the gland projections have a variety of abnormalities, including additional branching, swelling and thickening, and abnormal trajectories; the gland phenotype becomes progressively more severe as animals develop; gland projection in sma-1 animals is considerably overgrown compared with wild type; the cross-sectional area of the g1P projection is 2.5-fold larger in sma-1 compared to WT | Paper_evidence | WBPaper00040002 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005788 | PATO:0000460 | Paper_evidence | WBPaper00040002 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00040002 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00040002 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000946 | Paper_evidence | WBPaper00040002 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | the pharyngeal neuron I3 (which lies in direct contact with the anterior portion of the g1P projection) appears normal in iv38 animals. | Paper_evidence | WBPaper00040002 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004742 | PATO:0000460 | Paper_evidence | WBPaper00040002 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000961 | Paper_evidence | WBPaper00040002 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | iv37 animals had wild-type numbers of expressing cells | Paper_evidence | WBPaper00040002 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005788 | PATO:0000460 | Paper_evidence | WBPaper00040002 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00040002 | ||||||||
Method | Substitution_allele |