WormBase Tree Display for Variation: WBVar00601023
expand all nodes | collapse all nodes | view schema
| WBVar00601023 | Evidence | Paper_evidence | WBPaper00031592 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | hp369 | |||||
| Other_name | CE47428:p.Arg649Ter | ||||||
| F25C8.3a.1:c.1945C>T | |||||||
| F25C8.3d.1:c.1945C>T | |||||||
| F25C8.3e.1:c.1945C>T | |||||||
| CE41563:p.Arg649Ter | |||||||
| F25C8.3c.1:c.1891C>T | |||||||
| F25C8.3b.1:c.1945C>T | |||||||
| CE47217:p.Arg631Ter | |||||||
| CE47117:p.Arg649Ter | |||||||
| CE43592:p.Arg649Ter | |||||||
| HGVSg | CHROMOSOME_V:g.20885654C>T | ||||||
| Sequence_details | SMap | S_parent | Sequence | F25C8 | |||
| Flanking_sequences | cttgcaccccatcctactacaaattctcga | gaagttcacttaatacgctatcacgacggg | |||||
| Mapping_target | F25C8 | ||||||
| Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00031592 | ||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Laboratory | ZM | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00006812 | |||||
| Transcript | F25C8.3d.1 | VEP_consequence | stop_gained | ||||
| VEP_impact | HIGH | ||||||
| HGVSc | F25C8.3d.1:c.1945C>T | ||||||
| HGVSp | CE43592:p.Arg649Ter | ||||||
| cDNA_position | 1945 | ||||||
| CDS_position | 1945 | ||||||
| Protein_position | 649 | ||||||
| Exon_number | 10/37 | ||||||
| Codon_change | Cga/Tga | ||||||
| Amino_acid_change | R/* | ||||||
| F25C8.3b.1 | VEP_consequence | stop_gained | |||||
| VEP_impact | HIGH | ||||||
| HGVSc | F25C8.3b.1:c.1945C>T | ||||||
| HGVSp | CE47117:p.Arg649Ter | ||||||
| cDNA_position | 2198 | ||||||
| CDS_position | 1945 | ||||||
| Protein_position | 649 | ||||||
| Exon_number | 11/36 | ||||||
| Codon_change | Cga/Tga | ||||||
| Amino_acid_change | R/* | ||||||
| F25C8.3e.1 | VEP_consequence | stop_gained | |||||
| VEP_impact | HIGH | ||||||
| HGVSc | F25C8.3e.1:c.1945C>T | ||||||
| HGVSp | CE47428:p.Arg649Ter | ||||||
| cDNA_position | 1945 | ||||||
| CDS_position | 1945 | ||||||
| Protein_position | 649 | ||||||
| Exon_number | 10/34 | ||||||
| Codon_change | Cga/Tga | ||||||
| Amino_acid_change | R/* | ||||||
| F25C8.3c.1 | VEP_consequence | stop_gained | |||||
| VEP_impact | HIGH | ||||||
| HGVSc | F25C8.3c.1:c.1891C>T | ||||||
| HGVSp | CE47217:p.Arg631Ter | ||||||
| cDNA_position | 1891 | ||||||
| CDS_position | 1891 | ||||||
| Protein_position | 631 | ||||||
| Exon_number | 10/35 | ||||||
| Codon_change | Cga/Tga | ||||||
| Amino_acid_change | R/* | ||||||
| F25C8.3a.1 | VEP_consequence | stop_gained | |||||
| VEP_impact | HIGH | ||||||
| HGVSc | F25C8.3a.1:c.1945C>T | ||||||
| HGVSp | CE41563:p.Arg649Ter | ||||||
| cDNA_position | 1945 | ||||||
| CDS_position | 1945 | ||||||
| Protein_position | 649 | ||||||
| Exon_number | 10/37 | ||||||
| Codon_change | Cga/Tga | ||||||
| Amino_acid_change | R/* | ||||||
| Genetics | Interpolated_map_position | V | 25.5735 | ||||
| Description | Phenotype | WBPhenotype:0001592 | Paper_evidence | WBPaper00031592 | |||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | Animals exhibit recessive and fully penetrant fainter phenotypes identical to that of the nca(lf) double mutant. | Paper_evidence | WBPaper00031592 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Recessive | Paper_evidence | WBPaper00031592 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Reference | WBPaper00031592 | ||||||
| Method | Substitution_allele |
