WormBase Tree Display for Variation: WBVar00600958

WBVar00600958 Name: Public_name: tm5595
    Other_name: C04F5.3.1:c.208-7_334-5del
    HGVSg: CHROMOSOME_V:g.5098405_5098583del
  Sequence_details: SMap: S_parent: Sequence: C04F5
    Flanking_sequences: tcaaggcgctttgcacgcatttcttcctgt tttaagtaacatttagttagaaattttgtg
    Mapping_target: C04F5
    Source_location: 7 CHROMOSOME_V 5098404 5098584 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm5595_external
      tm5595_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 5595
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00006782
    Transcript: C04F5.3.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: C04F5.3.1:c.208-7_334-5del
        Intron_number: 3-4/8
        Exon_number: 4/9
  Isolation: Mutagen: TMP/UV
  Genetics: Map: V
  Description: Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 9025/9026-9204/9205 (179 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele