WormBase Tree Display for Variation: WBVar00600743
expand all nodes | collapse all nodes | view schema
WBVar00600743 | Evidence | Paper_evidence | WBPaper00038069 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | wk156 | |||||
Other_name | F08C6.1c.1:c.1090G>A | ||||||
CE47865:p.Gly364Ser | |||||||
CE48012:p.Gly364Ser | |||||||
F08C6.1a.1:c.1090G>A | |||||||
HGVSg | CHROMOSOME_X:g.7590093G>A | ||||||
Sequence_details | SMap | S_parent | Sequence | F08C6 | |||
Flanking_sequences | acctctgcttttatcgggacacacgaactc | gccataggtttacagtaacataaagaagtt | |||||
Mapping_target | F08C6 | ||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00038069 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00005159 | ||||||
Laboratory | LT | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00000083 | |||||
Transcript | F08C6.1c.1 (12) | ||||||
F08C6.1a.1 (12) | |||||||
Interactor (11) | |||||||
Genetics | Interpolated_map_position | X | -1.47956 | ||||
Description | Phenotype | WBPhenotype:0000229 | Paper_evidence | WBPaper00038069 | |||
Curator_confirmed | WBPerson712 | ||||||
Remark | Semi-small. Fails to complement tm975 for body size. Newly hatched adt-2 mutant larvae have the same body length as control animals. adt-2 mutant worms grow more slowly after 24 hours resulting in adult worms with about a 20% reduced body length when compared to wild type. | Paper_evidence | WBPaper00038069 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000583 | Paper_evidence | WBPaper00038069 | |||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000676 | Paper_evidence | WBPaper00038069 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | adt-2 mutant worms grow more slowly after 24 hours. | Paper_evidence | WBPaper00038069 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0001017 | Paper_evidence | WBPaper00038069 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | Adult adt-2 mutants show a significant decrease in body length between 96 and 120 h, whereas wild-type animals continue to grow larger during adulthood. | Paper_evidence | WBPaper00038069 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0001171 | Paper_evidence | WBPaper00038069 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | adt-2(wk156)mutants have significantly reduced lifespans compared to wild type, with a median survival of 10 and 8 days from adulthood, respectively, compared with 16 days for wild type. | Paper_evidence | WBPaper00038069 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0001517 | Paper_evidence | WBPaper00038069 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | The annuli are constricted. In adt-2(tm975/wk156) transheterozygous animals, patches of disorganized annuli are observed as well as structural defects in the alae. The defects are discontinuous alae and alae with two or four ridges as compared to three ridges in the wild-type worms. | Paper_evidence | WBPaper00038069 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0001727 | Paper_evidence | WBPaper00038069 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | Mutants show a significantly increased body width compared to N2 wild-type controls grown concurrently under the same conditions. | Paper_evidence | WBPaper00038069 | ||||
Curator_confirmed | WBPerson712 | ||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00038069 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0002025 | Paper_evidence | WBPaper00038069 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | The perimeters of individual seam cells are reduced significantly compared to wild-type animals. | Paper_evidence | WBPaper00038069 | ||||
Curator_confirmed | WBPerson712 | ||||||
Phenotype_not_observed | WBPhenotype:0000171 | Paper_evidence | WBPaper00038069 | ||||
Curator_confirmed | WBPerson712 | ||||||
Remark | adt-2(wk156)mutants have normal numbers of seam cells, intestinal cells, and hypodermal nuclei compared with wild-type controls. | Paper_evidence | WBPaper00038069 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000709 | Paper_evidence | WBPaper00038069 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | The length of the pharynx is not affected. | Paper_evidence | WBPaper00038069 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000961 | Paper_evidence | WBPaper00038069 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | No significant disruption of the COL-19::GFP organization is observed. | Paper_evidence | WBPaper00038069 | ||||
Curator_confirmed | WBPerson712 | ||||||
Reference | WBPaper00038069 | ||||||
Method | Substitution_allele |