WormBase Tree Display for Variation: WBVar00531948
expand all nodes | collapse all nodes | view schema
WBVar00531948 | Evidence | Paper_evidence | WBPaper00044390 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | bp500 | ||||||
Other_name | C32D5.9.1:c.256C>T | |||||||
CE01849:p.Gln86Ter | ||||||||
HGVSg | CHROMOSOME_II:g.6347431G>A | |||||||
Sequence_details | SMap | S_parent | Sequence | C32D5 | ||||
Flanking_sequences | ctgttcttctttgtcaacaatgtcattcca | aaaccatgaccacaatgggacaactctacc | ||||||
Mapping_target | C32D5 | |||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00044390 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00055856 | |||||||
Laboratory | HZ | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00002980 | ||||||
Transcript | C32D5.9.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | |||||||
HGVSc | C32D5.9.1:c.256C>T | |||||||
HGVSp | CE01849:p.Gln86Ter | |||||||
cDNA_position | 289 | |||||||
CDS_position | 256 | |||||||
Protein_position | 86 | |||||||
Exon_number | 2/4 | |||||||
Codon_change | Caa/Taa | |||||||
Amino_acid_change | Q/* | |||||||
Interactor | WBInteraction000525232 | |||||||
WBInteraction000525257 | ||||||||
Genetics | Interpolated_map_position | II | -0.380824 | |||||
Description | Phenotype | WBPhenotype:0000243 | Paper_evidence | WBPaper00044390 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | The lgg-1(bp500) mutation resulted in a significant increase in the duration time of cell corpses observed in embryos (Figure S1D) | Paper_evidence | WBPaper00044390 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000679 | Paper_evidence | WBPaper00044390 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Authors found that phagosomal association of GFP-RAB-5, which is recruited at early phagosome maturation stages, decreased significantly in lgg-1(bp500) mutants (Figure 1G). | Paper_evidence | WBPaper00044390 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Authors found that phagosomal association of GFP-RAB-7, which is recruited at late phagosome maturation stages, decreased significantly in lgg-1(bp500) mutants (Figure 1H). | Paper_evidence | WBPaper00044390 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Phagosomal labeling by the lysosomal membrane protein LAAT-1 was reduced in lgg-1(bp500) mutants (Figure 1I). | Paper_evidence | WBPaper00044390 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | GFP-RAB-5 | Paper_evidence | WBPaper00044390 | ||||
Curator_confirmed | WBPerson2987 | |||||||
GFP-RAB-7 | Paper_evidence | WBPaper00044390 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
LAAT-1-mCHERRY | Paper_evidence | WBPaper00044390 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001181 | Paper_evidence | WBPaper00044390 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | The lgg-1(bp500) mutation resulted in a significant increase in the number of cell corpses observed in embryos (Table 1, Figure S1A,B) | Paper_evidence | WBPaper00044390 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001846 | Paper_evidence | WBPaper00044390 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Authors found that phagosomal association of GFP-RAB-5, which is recruited at early phagosome maturation stages, decreased significantly in lgg-1(bp500) mutants (Figure 1G). | Paper_evidence | WBPaper00044390 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Authors found that phagosomal association of GFP-RAB-7, which is recruited at late phagosome maturation stages, decreased significantly in lgg-1(bp500) mutants (Figure 1H). | Paper_evidence | WBPaper00044390 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Phagosomal labeling by the lysosomal membrane protein LAAT-1 was reduced in lgg-1(bp500) mutants (Figure 1I). | Paper_evidence | WBPaper00044390 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | GFP-RAB-5 | Paper_evidence | WBPaper00044390 | ||||
Curator_confirmed | WBPerson2987 | |||||||
GFP-RAB-7 | Paper_evidence | WBPaper00044390 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
LAAT-1-mCHERRY | Paper_evidence | WBPaper00044390 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002349 | Paper_evidence | WBPaper00044390 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Authors found significantly reduced YFP-2xFYVE labeling of cell corpses in lgg-1(bp500) mutants, suggesting that phosphatidylinositol 3-phosphate (PtdIns3P) generation and/or accumulation on phagosomes is affected (Figure 2A, B, S2C). | Paper_evidence | WBPaper00044390 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | YFP-2xFYVE, a marker for phosphatidylinositol 3-phosphate | Paper_evidence | WBPaper00044390 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_not_observed | WBPhenotype:0001301 | Paper_evidence | WBPaper00036384 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | P granules were spherical and evenly dispersed. Localization patterns were distinct from the localization of T12G3.1 fluorescent signals. | Paper_evidence | WBPaper00036384 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00036384 | |||||||
WBPaper00044390 | ||||||||
WBPaper00049000 | ||||||||
WBPaper00065712 | ||||||||
Remark | The lesion curated is that described in the Autophagy paper, which is different to that described in the earlier Mol. Cell paper. The author confirms that this is the correct lesion. | Curator_confirmed | WBPerson2970 | |||||
Method | Substitution_allele |