WormBase Tree Display for Variation: WBVar00296779
expand all nodes | collapse all nodes | view schema
WBVar00296779 | Evidence | Paper_evidence | WBPaper00037686 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | e2978 | |||||
Other_name | JC8.12b.1:c.213T>A | ||||||
JC8.12a.1:c.246T>A | |||||||
CE29812:p.Tyr82Ter | |||||||
CE39741:p.Tyr71Ter | |||||||
HGVSg | CHROMOSOME_IV:g.13257155T>A | ||||||
Sequence_details | SMap | S_parent | Sequence | JC8 | |||
Flanking_sequences | acgtcacattgtaattccatcgattcttta | acaatttcccaatggattactgtagcttca | |||||
Mapping_target | JC8 | ||||||
Type_of_mutation | Substitution | t | a | ||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Laboratory | CB | ||||||
Status | Live | ||||||
Affects (2) | |||||||
Genetics | Interpolated_map_position | IV | 8.50426 | ||||
Description | Phenotype | WBPhenotype:0001413 | Paper_evidence | WBPaper00037686 | |||
Curator_confirmed | WBPerson712 | ||||||
Remark | The Bus phenotype is more similar to br5 than to e2740. | Paper_evidence | WBPaper00037686 | ||||
Curator_confirmed | WBPerson712 | ||||||
Reference | WBPaper00037686 | ||||||
Method | Substitution_allele |