WormBase Tree Display for Variation: WBVar00296483
expand all nodes | collapse all nodes | view schema
WBVar00296483 | Evidence | Paper_evidence | WBPaper00003948 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | n3238 | ||||||
Other_name | Y41D4B.13a.1:c.439+1G>A | |||||||
HGVSg | CHROMOSOME_IV:g.1597759G>A | |||||||
Sequence_details | SMap | S_parent | Sequence | Y41D4B | ||||
Flanking_sequences | ttgagcaaggagagcggctcgagattcttt | tgagctttaaagcagcacttttttgattaa | ||||||
Mapping_target | Y41D4B | |||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00003948 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | MT | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00000416 | ||||||
Transcript | Y41D4B.13a.1 | VEP_consequence | splice_donor_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | Y41D4B.13a.1:c.439+1G>A | |||||||
Intron_number | 2/4 | |||||||
Genetics | Interpolated_map_position | IV | -16.6556 | |||||
Description | Phenotype | WBPhenotype:0000241 | Paper_evidence | WBPaper00003948 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000301 | Paper_evidence | WBPaper00003948 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Distal tip cells did not follow a typical path, resulting in gonad arms that exhibited inappropriate turns, twists, or positions with in the body cavity. | Paper_evidence | WBPaper00003948 | |||||
Curator_confirmed | WBPerson712 | |||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00003948 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed | WBPhenotype:0000188 | Paper_evidence | WBPaper00003948 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Gonadal arms were as long as those in wild-type animals; germ cells were organized properly as well. | Paper_evidence | WBPaper00003948 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001656 | Paper_evidence | WBPaper00003948 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Initiating and maintaining a trajectory is normal. | Paper_evidence | WBPaper00003948 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00003948 | |||||||
Method | Substitution_allele |