WormBase Tree Display for Variation: WBVar00296444
expand all nodes | collapse all nodes | view schema
WBVar00296444 | Evidence | Paper_evidence | WBPaper00036352 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | sm211 | |||||||
Other_name | F11F1.7.1:c.127G>A | ||||||||
CE47922:p.Val43Met | |||||||||
HGVSg | CHROMOSOME_III:g.13404887G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | F11F1 | |||||
Flanking_sequences | tgcccaacagatcctgaagctgttaaaaaa | tgcatatcgatttgtgggatgaagattgta | |||||||
Mapping_target | F11F1 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00036352 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | CU | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00008719 | |||||||
Transcript | F11F1.7.1 (12) | ||||||||
Genetics | Interpolated_map_position | III | 21.2132 | ||||||
Description | Phenotype | WBPhenotype:0002365 | Paper_evidence | WBPaper00046306 | |||||
Curator_confirmed | WBPerson9270 | ||||||||
Remark | Table S1 | Paper_evidence | WBPaper00046306 | ||||||
Curator_confirmed | WBPerson9270 | ||||||||
Phenotype_not_observed | WBPhenotype:0001621 | Paper_evidence | WBPaper00053620 | ||||||
Curator_confirmed | WBPerson28450 | ||||||||
WBPhenotype:0002478 | Paper_evidence | WBPaper00053323 | |||||||
Curator_confirmed | WBPerson9270 | ||||||||
Remark | Figure 5, level of phosphatidylserine exposed on the PLM axon after axotomy unchanged compared to wild type | Paper_evidence | WBPaper00053323 | ||||||
Curator_confirmed | WBPerson9270 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005490 | PATO:0000460 | Paper_evidence | WBPaper00053323 | ||||
Curator_confirmed | WBPerson9270 | ||||||||
GO_term | GO:0030424 | PATO:0000460 | Paper_evidence | WBPaper00053323 | |||||
Curator_confirmed | WBPerson9270 | ||||||||
Molecule_affected | WBMol:00003183 | PATO:0000460 | Paper_evidence | WBPaper00053323 | |||||
Curator_confirmed | WBPerson9270 | ||||||||
Reference | WBPaper00036352 | ||||||||
WBPaper00046306 | |||||||||
WBPaper00053620 | |||||||||
WBPaper00053323 | |||||||||
Method | Substitution_allele |