WormBase Tree Display for Variation: WBVar00278318

WBVar00278318 Evidence: Paper_evidence: WBPaper00004490
  Name: Public_name: q154
    Other_name: Y113G7B.5b.1:c.3G>A
      CE23287:p.Met1?
      CE39287:p.Met1?
      Y113G7B.5a.1:c.3G>A
    HGVSg: CHROMOSOME_V:g.20199296G>A
  Sequence_details: SMap: S_parent: Sequence: Y113G7B
    Flanking_sequences: cgccggatttcaaccaatcgaaacgaaaat agtgaaaatttgacggatgagttggatttg
    Mapping_target: Y113G7B
    Type_of_mutation: Substitution: g a Paper_evidence: WBPaper00004490
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: JK
    Status: Live
  Affects: Gene: WBGene00001482
    Transcript: Y113G7B.5b.1 (12)
      Y113G7B.5a.1 (12)
  Genetics: Interpolated_map_position: V 24.9178
  Description: Phenotype: WBPhenotype:0001683 Paper_evidence: WBPaper00001037
        Curator_confirmed: WBPerson2021
        Remark: There is no evidence of sperm, spermatogenesis, or germ cell death in fog-2 XX mutants. Further, oogenesis begins in fog-2 mutants at about the time spermatogenesis begins in wild type. fog-2 X0 males are unaffected Paper_evidence: WBPaper00001037
            Curator_confirmed: WBPerson2021
        Recessive: Paper_evidence: WBPaper00001037
          Curator_confirmed: WBPerson2021
        Variation_effect: Hypomorph_reduction_of_function: Paper_evidence: WBPaper00001037
            Curator_confirmed: WBPerson2021
  Reference: WBPaper00001037
    WBPaper00004490
  Method: Substitution_allele