WormBase Tree Display for Variation: WBVar00278185
expand all nodes | collapse all nodes | view schema
WBVar00278185 | Evidence | Paper_evidence | WBPaper00036200 | ||
---|---|---|---|---|---|
Name | Public_name | e3003 | |||
Other_name (22) | |||||
HGVSg | CHROMOSOME_II:g.14657745G>T | ||||
Sequence_details | SMap | S_parent | Sequence | ZC101 | |
Flanking_sequences | CCGGCATCCTGCAATTGTGTCGACGGAATC | TCAAGACTCCACGATCATCACTAGATCCAA | |||
Mapping_target | ZC101 | ||||
Type_of_mutation | Substitution | G | T | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00005866 | ||||
Laboratory | VC | ||||
CB | |||||
DM | |||||
Analysis | Million_Mutation_Pilot_Project | ||||
KO_consortium_allele | |||||
Status | Live | ||||
Affects | Gene | WBGene00006787 | |||
Transcript | ZC101.2l.1 (12) | ||||
ZC101.2c.1 | VEP_consequence | intron_variant | |||
VEP_impact | MODIFIER | ||||
HGVSc | ZC101.2c.1:c.5083+293C>A | ||||
Intron_number | 17/23 | ||||
ZC101.2f.1 (12) | |||||
ZC101.2j.1 | VEP_consequence | intron_variant | |||
VEP_impact | MODIFIER | ||||
HGVSc | ZC101.2j.1:c.4787-254C>A | ||||
Intron_number | 15/22 | ||||
ZC101.2o.1 (12) | |||||
ZC101.2n.1 | VEP_consequence | intron_variant | |||
VEP_impact | MODIFIER | ||||
HGVSc | ZC101.2n.1:c.5084-254C>A | ||||
Intron_number | 16/23 | ||||
ZC101.2d.1 (12) | |||||
ZC101.2e.1 (12) | |||||
ZC101.2k.1 (12) | |||||
ZC101.2m.1 (12) | |||||
ZC101.2a.1 (12) | |||||
ZC101.2i.1 | VEP_consequence | intron_variant | |||
VEP_impact | MODIFIER | ||||
HGVSc | ZC101.2i.1:c.4787-648C>A | ||||
Intron_number | 16/22 | ||||
ZC101.2r.1 (12) | |||||
Isolation | Mutagen | EMS | |||
Reference | WBPaper00036200 | ||||
Remark | Allele identified through whole-genome sequencing by the Gene Knockout Consortium | Paper_evidence | WBPaper00036200 | ||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||
Method | KO_consortium_allele |