WormBase Tree Display for Variation: WBVar00276752

WBVar00276752 Evidence: Paper_evidence: WBPaper00036200
  Name: Public_name: gk2043
    Other_name: CE26370:p.Ser1157=
      F57C12.4.1:c.3471A>T
    HGVSg: CHROMOSOME_X:g.565514T>A
  Sequence_details: SMap: S_parent: Sequence: F57C12
    Flanking_sequences: GAAATTATCAACAACGCCAAAAGCACGAAT GAAGATGCACCTTGGATAGATTCCTGTAAC
    Mapping_target: F57C12
    Type_of_mutation: Substitution: T A
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00036970
    Laboratory: VC
    Person: WBPerson427
    Analysis: Million_Mutation_Pilot_Project
    KO_consortium_allele
    Status: Live
  Affects: Gene: WBGene00003408
    Transcript: F57C12.4.1 VEP_consequence: synonymous_variant
        VEP_impact: LOW
        HGVSc: F57C12.4.1:c.3471A>T
        HGVSp: CE26370:p.Ser1157=
        cDNA_position: 3529
        CDS_position: 3471
        Protein_position: 1157
        Exon_number: 15/20
        Codon_change: tcA/tcT
        Amino_acid_change: S
  Isolation: Mutagen: EMS
  Reference: WBPaper00036200
  Remark: Allele identified through whole-genome sequencing by the Gene Knockout Consortium Paper_evidence: WBPaper00036200
    Sequenced by the C. elegans Gene Knockout Consortium Paper_evidence: WBPaper00041807
  Method: KO_consortium_allele