WormBase Tree Display for Variation: WBVar00276736

WBVar00276736 Evidence: Paper_evidence: WBPaper00036200
  Name: Public_name: gk2716
    Other_name: CE28463:p.Val333=
      F56C11.1.1:c.999G>A
      F56C11.1.2:c.999G>A
    HGVSg: CHROMOSOME_I:g.152552C>T
  Sequence_details: SMap: S_parent: Sequence: F56C11
    Flanking_sequences: TCCTCGTTTTCTCAGAAGCATTGCTGGTGG ACAATTGAGTGAGGGAACCTGAAGGCGGCT
    Mapping_target: F56C11
    Type_of_mutation: Substitution: C T
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00005866
    Laboratory: VC
    Person: WBPerson427
    Analysis: Million_Mutation_Pilot_Project
    KO_consortium_allele
    Status: Live
  Affects: Gene: WBGene00000253
    Transcript: F56C11.1.1 VEP_consequence: synonymous_variant
        VEP_impact: LOW
        HGVSc: F56C11.1.1:c.999G>A
        HGVSp: CE28463:p.Val333=
        cDNA_position: 1035
        CDS_position: 999
        Protein_position: 333
        Exon_number: 7/21
        Codon_change: gtG/gtA
        Amino_acid_change: V
      F56C11.1.2 VEP_consequence: synonymous_variant
        VEP_impact: LOW
        HGVSc: F56C11.1.2:c.999G>A
        HGVSp: CE28463:p.Val333=
        cDNA_position: 1035
        CDS_position: 999
        Protein_position: 333
        Exon_number: 7/21
        Codon_change: gtG/gtA
        Amino_acid_change: V
  Isolation: Mutagen: EMS
  Reference: WBPaper00036200
  Remark: Allele identified through whole-genome sequencing by the Gene Knockout Consortium Paper_evidence: WBPaper00036200
    Sequenced by the C. elegans Gene Knockout Consortium Paper_evidence: WBPaper00041807
  Method: KO_consortium_allele