WormBase Tree Display for Variation: WBVar00275545
expand all nodes | collapse all nodes | view schema
WBVar00275545 | Evidence | Paper_evidence | WBPaper00046634 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | zu364 | |||||
Other_name | CE46780:p.Arg297Cys | ||||||
K05C4.6b.1:c.889C>T | |||||||
K05C4.6a.1:c.811C>T | |||||||
CE19974:p.Arg271Cys | |||||||
HGVSg | CHROMOSOME_I:g.14740565C>T | ||||||
Sequence_details | SMap | S_parent | Sequence | K05C4 | |||
Flanking_sequences | gatcatcggaagctcatctataccgtcgtc | gttgcattcgatccctgtccgtttgtccga | |||||
Mapping_target | K05C4 | ||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00046634 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00022480 | ||||||
Laboratory | JJ | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00001979 | |||||
Transcript | K05C4.6a.1 (12) | ||||||
K05C4.6b.1 (12) | |||||||
Interactor | WBInteraction000502143 | ||||||
WBInteraction000521880 | |||||||
WBInteraction000521881 | |||||||
WBInteraction000521883 | |||||||
WBInteraction000521885 | |||||||
WBInteraction000542220 | |||||||
WBInteraction000542221 | |||||||
WBInteraction000542222 | |||||||
Genetics | Interpolated_map_position | I | 26.5838 | ||||
Mapping_data | In_multi_point | 4409 | |||||
Description | Phenotype | WBPhenotype:0000050 | Paper_evidence | WBPaper00037107 | |||
Curator_confirmed | WBPerson503 | ||||||
WBPhenotype:0000436 | Paper_evidence | WBPaper00046634 | |||||
Curator_confirmed | WBPerson20938 | ||||||
Remark | hmp-2(zu364) is a R271C point mutant. It shows inability to localize to adherens junctions. | Paper_evidence | WBPaper00046634 | ||||
Curator_confirmed | WBPerson20938 | ||||||
WBPhenotype:0001745 | Paper_evidence | WBPaper00046634 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | hmp-2(zu364) is a R271C point mutant. It shows inability to localize to adherens junctions. | Paper_evidence | WBPaper00046634 | ||||
Curator_confirmed | WBPerson712 | ||||||
Reference | WBPaper00037107 | ||||||
WBPaper00046634 | |||||||
Method | Substitution_allele |