WormBase Tree Display for Variation: WBVar00275491
expand all nodes | collapse all nodes | view schema
WBVar00275491 | Evidence | Paper_evidence | WBPaper00030735 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | zu129 | |||||||
Other_name | CE27591:p.Trp198Ter | ||||||||
T19E7.2a.1:c.594G>A | |||||||||
T19E7.2c.1:c.324G>A | |||||||||
CE31239:p.Trp108Ter | |||||||||
HGVSg | CHROMOSOME_IV:g.5655282C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | T19E7 | |||||
Flanking_sequences | cgaggatatcgacttgattgatgtgctatg | agaagtgatattgctggagagaagggcaca | |||||||
Mapping_target | T19E7 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | |||||
Person_evidence | WBPerson1729 | ||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00007253 | ||||||||
Laboratory | JJ | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00004804 | |||||||
Transcript | T19E7.2a.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | T19E7.2a.1:c.594G>A | ||||||||
HGVSp | CE27591:p.Trp198Ter | ||||||||
cDNA_position | 594 | ||||||||
CDS_position | 594 | ||||||||
Protein_position | 198 | ||||||||
Exon_number | 3/9 | ||||||||
Codon_change | tgG/tgA | ||||||||
Amino_acid_change | W/* | ||||||||
T19E7.2c.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | T19E7.2c.1:c.324G>A | ||||||||
HGVSp | CE31239:p.Trp108Ter | ||||||||
cDNA_position | 324 | ||||||||
CDS_position | 324 | ||||||||
Protein_position | 108 | ||||||||
Exon_number | 1/6 | ||||||||
Codon_change | tgG/tgA | ||||||||
Amino_acid_change | W/* | ||||||||
Interactor | WBInteraction000501233 | ||||||||
WBInteraction000501235 | |||||||||
WBInteraction000501239 | |||||||||
WBInteraction000501241 | |||||||||
Genetics | Interpolated_map_position | IV | 2.04045 | ||||||
Description | Phenotype | WBPhenotype:0000052 | Paper_evidence | WBPaper00001521 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00001521 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00001521 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00001521 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Maternal | Strictly_maternal | Paper_evidence | WBPaper00001521 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000111 | Paper_evidence | WBPaper00035964 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | The number of cells expressing end-1 and elt-2 within individual mutant embryos also varied greatly from embryo to embryo, unlike wild-type | Paper_evidence | WBPaper00035964 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000137 | Paper_evidence | WBPaper00035964 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | med-1 and med-2 transcripts were essentially absent, and end-3 transcript numbers were greatly diminished. elt-2 transcripts are around 20-30% lower than the wild type. pop-1 mRNA levels in the skn-1 mutant embryos were virtually identical to those in the wild type | Paper_evidence | WBPaper00035964 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000717 | Paper_evidence | WBPaper00035964 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | end-1 expression began approximately one cell cycle later than in the wild-type. Also, inter-embryo variation in end-1 expression was much higher than in wild-type | Paper_evidence | WBPaper00035964 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001171 | Paper_evidence | WBPaper00046170 | |||||||
Curator_confirmed | WBPerson5092 | ||||||||
Remark | compared to N2. Completely suppresses longevity of daf-2(e1370) at 15C, but no suppression at 20C. | Paper_evidence | WBPaper00046170 | ||||||
Curator_confirmed | WBPerson5092 | ||||||||
WBPhenotype:0001637 | Paper_evidence | WBPaper00001521 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | skn-1 embryos also appear to lack an intestine (confirmed via antibody staining) and lack birefringent gut granules | Paper_evidence | WBPaper00001521 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00001521 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Range | 14 | 46 | Paper_evidence | WBPaper00001521 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00001521 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00001521 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00001521 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Maternal | Strictly_maternal | Paper_evidence | WBPaper00001521 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | antibody staining with 2CB7(stains intestinal cells) | Paper_evidence | WBPaper00001521 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Temperature | 15C, 25C | Paper_evidence | WBPaper00001521 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001646 | Paper_evidence | WBPaper00001521 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | skn-1 mutant embryos do not contain any structures that morphologically resemble a pharynx (confirmed via antibody staining) | Paper_evidence | WBPaper00001521 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance | High | Paper_evidence | WBPaper00001521 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Range | 84 | 96 | Paper_evidence | WBPaper00001521 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00001521 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00001521 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00001521 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Maternal | Strictly_maternal | Paper_evidence | WBPaper00001521 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | antibody staining with 9.2.1(stains pharyngeal-specific muscle cells) | Paper_evidence | WBPaper00001521 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Temperature | 15C, 25C | Paper_evidence | WBPaper00001521 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00001521 | ||||||||
WBPaper00035964 | |||||||||
WBPaper00046170 | |||||||||
Method | Substitution_allele |