WormBase Tree Display for Variation: WBVar00275444
expand all nodes | collapse all nodes | view schema
WBVar00275444 | Evidence | Paper_evidence | WBPaper00025639 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | yt2 | ||||||
Other_name | CE26746:p.Trp270Ter | |||||||
EEED8.1.1:c.810G>A | ||||||||
HGVSg | CHROMOSOME_II:g.5422271G>A | |||||||
Sequence_details | SMap | S_parent | Sequence | F07F6 | ||||
Flanking_sequences | tgataatattcgcgaggttgttaaaaaatg | ggacaaatggaaaattcgacgcttcacgcc | ||||||
Mapping_target | F07F6 | |||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00025639 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00031149 | |||||||
Laboratory | QA | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00017132 | ||||||
Transcript | EEED8.1.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | |||||||
HGVSc | EEED8.1.1:c.810G>A | |||||||
HGVSp | CE26746:p.Trp270Ter | |||||||
cDNA_position | 841 | |||||||
CDS_position | 810 | |||||||
Protein_position | 270 | |||||||
Exon_number | 6/9 | |||||||
Codon_change | tgG/tgA | |||||||
Amino_acid_change | W/* | |||||||
Interactor | WBInteraction000502737 | |||||||
WBInteraction000525290 | ||||||||
Genetics | Interpolated_map_position | II | -1.63601 | |||||
Mapping_data | In_multi_point | 5279 | ||||||
Description | Phenotype | WBPhenotype:0000052 | Paper_evidence | WBPaper00025639 | ||||
WBPaper00028911 | ||||||||
Curator_confirmed | WBPerson48 | |||||||
WBPerson557 | ||||||||
Remark | mel-47(yt2) mutants arrest as disorganized embryos with 50 to 80 cells of variable size. | Paper_evidence | WBPaper00028911 | |||||
Curator_confirmed | WBPerson557 | |||||||
Penetrance | Complete | Paper_evidence | WBPaper00025639 | |||||
Curator_confirmed | WBPerson48 | |||||||
Maternal | ||||||||
WBPhenotype:0001114 | Paper_evidence | WBPaper00028911 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Remark | mel-47 is required maternally for the proper execution of the early cell cycles. | Paper_evidence | WBPaper00028911 | |||||
Curator_confirmed | WBPerson557 | |||||||
Reference (2) | ||||||||
Method | Substitution_allele |