WormBase Tree Display for Variation: WBVar00275342
expand all nodes | collapse all nodes | view schema
WBVar00275342 | Evidence | Paper_evidence | WBPaper00031121 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | y263 | ||||||
Other_name | F44A6.2.1:c.659-1G>A | |||||||
HGVSg | CHROMOSOME_X:g.10202728C>T | |||||||
Sequence_details | SMap | S_parent | Sequence | F44A6 | ||||
Flanking_sequences | aaaaaaaataaagatttaaatgttgtttca | ctgttcgccaaatgaagttcagaaatgcaa | ||||||
Mapping_target | F44A6 | |||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00031121 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin (4) | ||||||||
Affects | Gene | WBGene00004786 | ||||||
Transcript | F44A6.2.1 | VEP_consequence | splice_acceptor_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | F44A6.2.1:c.659-1G>A | |||||||
Intron_number | 4/8 | |||||||
Interactor (14) | ||||||||
Genetics | Interpolated_map_position | X | 1.88121 | |||||
Description | Phenotype (14) | |||||||
Phenotype_not_observed | WBPhenotype:0000065 | Paper_evidence | WBPaper00003262 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | No decrease in XO viability is observed in a y263 homozygous background alone. Further, sex-1(y263) reduces the XO lethality caused by the presence of 3 copies of sex-1(+). | Paper_evidence | WBPaper00003262 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Assay for suppression of extra copies of sex-1(+) occurred in the following background: stDp2/stDp2;him-5;unc-18 sex-1(y263). | Paper_evidence | WBPaper00003262 | ||||
Curator_confirmed | WBPerson712 | |||||||
Genotype | unc-1 or unc-2 | Paper_evidence | WBPaper00003262 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00015288 | |||||||
WBPaper00017234 | ||||||||
WBPaper00030931 | ||||||||
WBPaper00032450 | ||||||||
WBPaper00031121 | ||||||||
WBPaper00035459 | ||||||||
WBPaper00003262 | ||||||||
WBPaper00022872 | ||||||||
WBPaper00022084 | ||||||||
Method | Substitution_allele |