WormBase Tree Display for Variation: WBVar00275284
expand all nodes | collapse all nodes | view schema
WBVar00275284 | Evidence | Paper_evidence | WBPaper00031432 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | y1 | |||||||
Other_name | Y39A1B.3.1:c.3365G>A | ||||||||
CE31734:p.Gly1122Glu | |||||||||
HGVSg | CHROMOSOME_III:g.10771434G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | Y39A1B | |||||
Flanking_sequences | aacggcttttcgtaccgaataagcttatgg | gcggcttctaccgattgtcgtttacgggat | |||||||
Mapping_target | Y39A1B | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00031432 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00004578 | ||||||||
WBStrain00035088 | |||||||||
Laboratory | TY | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001087 | |||||||
Transcript | Y39A1B.3.1 (12) | ||||||||
Interactor | WBInteraction000052060 | ||||||||
Genetics | Interpolated_map_position | III | 5.36471 | ||||||
Mapping_data | In_multi_point | 1080 | |||||||
1081 | |||||||||
1082 | |||||||||
1083 | |||||||||
2062 | |||||||||
In_pos_neg_data | 2715 | ||||||||
5727 | |||||||||
5735 | |||||||||
Description | Phenotype | WBPhenotype:0000032 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | at 24C, maternal effect dumpy/near lethal; XX viable at 15C | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 24 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Maternal | With_maternal_effect | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000066 | Paper_evidence | WBPaper00001077 | |||||||
WBPaper00001011 | |||||||||
WBPaper00032450 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Dosage compensation mutations cause XX specific maternal effect lethality. | Paper_evidence | WBPaper00032450 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Maternal | With_maternal_effect | Paper_evidence | WBPaper00001077 | ||||||
WBPaper00001011 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | dpy-28(y1);him-5 | Paper_evidence | WBPaper00001077 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000583 | Paper_evidence | WBPaper00001077 | |||||||
WBPaper00001011 | |||||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals that escape lethality are Dpy. | Paper_evidence | WBPaper00001077 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
at 24C, XX phenotype is zygotic weak dumpy, maternal effect dumpy/near lethal | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 24 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Maternal | With_maternal_effect | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | dpy-28(y1);him-5 | Paper_evidence | WBPaper00001077 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000718 | Paper_evidence | WBPaper00001011 | |||||||
WBPaper00032450 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | As determined by the penetrance of the lin-14(n179) mutant phenotype, based on the [# mutant seam cell nuclei (undivided seam cell nuclei + nuclei that generated precocious alae)/ total # seam cell nuclei] animals after the L3 molt. | Paper_evidence | WBPaper00001011 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Dosage compensation mutations cause XX specific maternal effect lethality. | Paper_evidence | WBPaper00032450 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Maternal | |||||||||
Phenotype_assay | Treatment | Nomarski optics were used to follow the fates of the midbody seam cell nuclei of L3 animals raised at 24C. | Paper_evidence | WBPaper00001011 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature | 24 | Paper_evidence | WBPaper00001011 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000773 | Paper_evidence | WBPaper00032450 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Hermaphrodite and male progeny of mutant mothers showed chromosome segregation defects in many tissues, whereas dpy-27 mutants did not (scored for gut nuclei; Figure S6B), confirming that condensin I promotes mitotic chromosome segregation. | Paper_evidence | WBPaper00032450 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001175 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | at 24C, XX phenotype is 3% Him, XX at 15C, 0.4% Him | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 24 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001581 | Paper_evidence | WBPaper00001011 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals have 36%(n=20) mutant seam cell nuclei, similar to XXX lin-14 animals (26% n=25) and less mutant than XX lin-14 animals (77% n=40). | Paper_evidence | WBPaper00001011 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006913 | PATO:0000460 | Paper_evidence | WBPaper00001011 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000035 | PATO:0000460 | Paper_evidence | WBPaper00001011 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Nomarski optics were used to follow the fates of the midbody seam cell nuclei of L3 animals raised at 24C. | Paper_evidence | WBPaper00001011 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature | 24 | Paper_evidence | WBPaper00001011 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001631 | Paper_evidence | WBPaper00001011 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals produce a very small number of nullo-X oocytes (0.5%). | Paper_evidence | WBPaper00001011 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Low | Paper_evidence | WBPaper00001011 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000928 | Paper_evidence | WBPaper00001011 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Percent of lin-14 mutant seam cell nuclei in XO males is not different to that of males carrying lin-14 alone. | Paper_evidence | WBPaper00001011 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00001011 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | All animals were raised at 20C. | Paper_evidence | WBPaper00001011 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature | 20 | Paper_evidence | WBPaper00001011 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | lin-14(n179)/0 | Paper_evidence | WBPaper00001011 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001021 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | XO phenotype wildtype male (ME3) | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00013841 | ||||||||
WBPaper00001077 | |||||||||
WBPaper00013718 | |||||||||
WBPaper00001011 | |||||||||
WBPaper00016314 | |||||||||
WBPaper00013715 | |||||||||
WBPaper00032450 | |||||||||
WBPaper00013717 | |||||||||
WBPaper00015605 | |||||||||
WBPaper00016421 | |||||||||
Method | Substitution_allele |