WormBase Tree Display for Variation: WBVar00275215
expand all nodes | collapse all nodes | view schema
WBVar00275215 | Name | Public_name | x20 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | F21F3.5.1:c.199-1G>A | ||||||||
HGVSg | CHROMOSOME_I:g.4900477C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | F21F3 | |||||
Flanking_sequences | taatctttatctaatcttgaaccaatttca | cacgagattgatcagattatgacgtgttcg | |||||||
Mapping_target | F21F3 | ||||||||
Type_of_mutation | Substitution | g | a | Person_evidence | WBPerson22169 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin (4) | |||||||||
Affects | Gene | WBGene00006774 | |||||||
Transcript | F21F3.5.1 | VEP_consequence | splice_acceptor_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | F21F3.5.1:c.199-1G>A | ||||||||
Intron_number | 3/9 | ||||||||
Interactor | WBInteraction000502320 | ||||||||
Isolation | Reverse_genetics | PCR | |||||||
Genetics | Interpolated_map_position | I | -0.649245 | ||||||
Mapping_data | In_2_point | 243 | |||||||
244 | |||||||||
524 | |||||||||
In_multi_point (13) | |||||||||
Description | Phenotype | WBPhenotype:0000421 | Paper_evidence | WBPaper00034730 | |||||
WBPaper00035548 | |||||||||
WBPaper00027611 | |||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson712 | |||||||||
Remark | unc-38 mutants are resistant to levamisole | Paper_evidence | WBPaper00034730 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Affected_by | Molecule | WBMol:00004019 | Paper_evidence | WBPaper00034730 | |||||
WBPaper00027611 | |||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson712 | |||||||||
WBPhenotype:0000562 | Paper_evidence | WBPaper00000484 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00000484 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Affected_by | Molecule | WBMol:00004019 | Paper_evidence | WBPaper00000484 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | 1mM levamisole | Paper_evidence | WBPaper00000484 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00000484 | |||||||
WBPaper00035548 | |||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson712 | |||||||||
Remark | No backward motion in L1 larvae. Newly hatched larvae can barely move forward. Adults have a mild Unc defect where the mutants move forward in a slow decayed sine wave. | Paper_evidence | WBPaper00000484 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00000484 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00000484 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00000484 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000656 | Paper_evidence | WBPaper00034730 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | In unc-38(x20) mutants, steady-state currents were significantly smaller than in wild type, suggesting altered nAChR desensitization | Paper_evidence | WBPaper00034730 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001203 | Paper_evidence | WBPaper00034730 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | unc-38 mutants are resistant to nicotine | Paper_evidence | WBPaper00034730 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001316 | Paper_evidence | WBPaper00034730 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | ACh and levamisole-evoked PSCs were significantly reduced in mutants | Paper_evidence | WBPaper00034730 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_not_observed | WBPhenotype:0000315 | Paper_evidence | WBPaper00000484 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00000484 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000478 | Paper_evidence | WBPaper00000484 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutants tend to remain within the borders of bacterial lawns as does the wild-type. | Paper_evidence | WBPaper00000484 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00000484 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000964 | Paper_evidence | WBPaper00027611 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00000896 | Paper_evidence | WBPaper00027611 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001084 | Paper_evidence | WBPaper00000484 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Attraction to sodium chloride is normal (See methods). | Paper_evidence | WBPaper00000484 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00000484 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001414 | Paper_evidence | WBPaper00000484 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00000484 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00027611 | ||||||||
WBPaper00035548 | |||||||||
WBPaper00034730 | |||||||||
WBPaper00000484 | |||||||||
WBPaper00016088 | |||||||||
Remark | cag to caa Splice-site Point Mutation. | Person_evidence | WBPerson22169 | ||||||
Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00006774 Acceptor | |||||||||
Method | Substitution_allele |