WormBase Tree Display for Variation: WBVar00275213
expand all nodes | collapse all nodes | view schema
WBVar00275213 | Name | Public_name | x18 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | Y110A7A.3.1:c.110-1G>A | |||||||
HGVSg | CHROMOSOME_I:g.5142174G>A | |||||||
Sequence_details | SMap | S_parent | Sequence | Y110A7A | ||||
Flanking_sequences | tcgccaaaaagaaaaactaaaaatatttca | attacaataaactggtgcgaccggtcagtg | ||||||
Mapping_target | Y110A7A | |||||||
Type_of_mutation | Substitution | g | a | |||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00040032 | |||||||
WBStrain00040929 | ||||||||
Laboratory | ZZ | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00006797 | ||||||
Transcript | Y110A7A.3.1 | VEP_consequence | splice_acceptor_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | Y110A7A.3.1:c.110-1G>A | |||||||
Intron_number | 2/11 | |||||||
Isolation | Mutagen | EMS | Paper_evidence | WBPaper00024268 | ||||
Genetics | Interpolated_map_position | I | -0.357566 | |||||
Mapping_data | In_2_point | 245 | ||||||
246 | ||||||||
In_multi_point | 238 | |||||||
973 | ||||||||
991 | ||||||||
2093 | ||||||||
Description | Phenotype | WBPhenotype:0000017 | Paper_evidence | WBPaper00000484 | ||||
Curator_confirmed | WBPerson2021 | |||||||
Recessive | Paper_evidence | WBPaper00000484 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Affected_by | Molecule | WBMol:00003650 | Paper_evidence | WBPaper00000484 | ||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Treatment | 2mM aldicarb | Paper_evidence | WBPaper00000484 | ||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0000421 | Paper_evidence | WBPaper00000484 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Recessive | Paper_evidence | WBPaper00000484 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Affected_by | Molecule | WBMol:00004019 | Paper_evidence | WBPaper00000484 | ||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Treatment | 1mM levamisole | Paper_evidence | WBPaper00000484 | ||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00000484 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | No backward motion in L1 larvae. Newly hatched larvae can barely move forward. Adults have a mild Unc defect where the mutants move forward in a slow decayed sine wave. | Paper_evidence | WBPaper00000484 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Recessive | Paper_evidence | WBPaper00000484 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
EQ_annotations | Life_stage (2) | |||||||
WBPhenotype:0001289 | Paper_evidence | WBPaper00000484 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Animals are resistant to the acetylcholinesterase inhibitors trichlorfon and eserine. | Paper_evidence | WBPaper00000484 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Recessive | Paper_evidence | WBPaper00000484 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Treatment | 1mM trichlorfon. 1mM eserine | Paper_evidence | WBPaper00000484 | ||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001578 | Paper_evidence | WBPaper00000484 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Animals are resistant to the cholinergic agonist carbachol. | Paper_evidence | WBPaper00000484 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Recessive | Paper_evidence | WBPaper00000484 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Treatment | 1mM carbachol | Paper_evidence | WBPaper00000484 | ||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_not_observed | WBPhenotype:0000315 | Paper_evidence | WBPaper00000484 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Recessive | Paper_evidence | WBPaper00000484 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0000478 | Paper_evidence | WBPaper00000484 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Mutants tend to remain within the borders of bacterial lawns as does the wild-type. | Paper_evidence | WBPaper00000484 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Recessive | Paper_evidence | WBPaper00000484 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001084 | Paper_evidence | WBPaper00000484 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Attraction to sodium chloride is normal (See methods). | Paper_evidence | WBPaper00000484 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Recessive | Paper_evidence | WBPaper00000484 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001414 | Paper_evidence | WBPaper00000484 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Recessive | Paper_evidence | WBPaper00000484 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Reference | WBPaper00000484 | |||||||
WBPaper00018321 | ||||||||
Method | Substitution_allele |