WormBase Tree Display for Variation: WBVar00275173
expand all nodes | collapse all nodes | view schema
WBVar00275173 | Evidence | Paper_evidence | WBPaper00025090 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | wk61 | |||||
Other_name | F58H12.1.1:c.820C>T | ||||||
CE28479:p.Gln274Ter | |||||||
HGVSg | CHROMOSOME_X:g.2849321G>A | ||||||
Sequence_details | SMap | S_parent | Sequence | F53B3 | |||
Flanking_sequences | acacagatggatgcacatccgagatgatgtg | aaaaaaatcaagcggcgcaactcctggaagc | |||||
Mapping_target | F53B3 | ||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00025090 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Laboratory | LT | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00002210 | |||||
Transcript | F58H12.1.1 | VEP_consequence | stop_gained | ||||
VEP_impact | HIGH | ||||||
HGVSc | F58H12.1.1:c.820C>T | ||||||
HGVSp | CE28479:p.Gln274Ter | ||||||
cDNA_position | 871 | ||||||
CDS_position | 820 | ||||||
Protein_position | 274 | ||||||
Exon_number | 9/18 | ||||||
Codon_change | Caa/Taa | ||||||
Amino_acid_change | Q/* | ||||||
Interactor | WBInteraction000500840 | ||||||
WBInteraction000502077 | |||||||
WBInteraction000518519 | |||||||
Isolation | Mutagen | EMS | |||||
Genetics | Interpolated_map_position | X | -12.6984 | ||||
Description | Phenotype | WBPhenotype:0000012 | Paper_evidence | WBPaper00005858 | |||
Curator_confirmed | WBPerson712 | ||||||
Remark | Weak Daf-c. | Paper_evidence | WBPaper00005858 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000031 | Paper_evidence | WBPaper00025090 | |||||
Curator_confirmed | WBPerson2021 | ||||||
Remark | kin-29 mutants grow more slowly than N2 | Paper_evidence | WBPaper00025090 | ||||
Curator_confirmed | WBPerson2021 | ||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00025090 | ||||
Curator_confirmed | WBPerson2021 | ||||||
WBPhenotype:0000136 | Paper_evidence | WBPaper00025090 | |||||
Curator_confirmed | WBPerson2021 | ||||||
Remark | kin-29(wk61) animals show an increase in the expression level of the lon-1 transcript. kin-29 does not affect dbl-1 or sma-6 mRNA expression levels | Paper_evidence | WBPaper00025090 | ||||
Curator_confirmed | WBPerson2021 | ||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00025090 | ||||
Curator_confirmed | WBPerson2021 | ||||||
WBPhenotype:0000154 | Paper_evidence | WBPaper00025090 | |||||
Curator_confirmed | WBPerson2021 | ||||||
Remark | kin-29(wk61) shows a brood size approximately 30% the size of that seen in wild-type animals | Paper_evidence | WBPaper00025090 | ||||
Curator_confirmed | WBPerson2021 | ||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00025090 | ||||
Curator_confirmed | WBPerson2021 | ||||||
WBPhenotype:0000229 | Paper_evidence | WBPaper00025090 | |||||
WBPaper00005858 | |||||||
Curator_confirmed | WBPerson2021 | ||||||
WBPerson712 | |||||||
Remark | kin-29(lf) animals are small. The Sma body size of kin-29 is due to a delay in development in later larval stages | Paper_evidence | WBPaper00025090 | ||||
Curator_confirmed | WBPerson2021 | ||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00025090 | ||||
Curator_confirmed | WBPerson2021 | ||||||
Phenotype_not_observed | WBPhenotype:0000070 | Paper_evidence | WBPaper00005858 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000296 | Paper_evidence | WBPaper00025090 | |||||
Curator_confirmed | WBPerson2021 | ||||||
Remark | No crumpled spicules | Paper_evidence | WBPaper00025090 | ||||
Curator_confirmed | WBPerson2021 | ||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00025090 | ||||
Curator_confirmed | WBPerson2021 | ||||||
WBPhenotype:0000297 | Paper_evidence | WBPaper00025090 | |||||
Curator_confirmed | WBPerson2021 | ||||||
Remark | kin-29 mutants do not display male tail ray fusions | Paper_evidence | WBPaper00025090 | ||||
Curator_confirmed | WBPerson2021 | ||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00025090 | ||||
Curator_confirmed | WBPerson2021 | ||||||
Reference | WBPaper00005858 | ||||||
WBPaper00025090 | |||||||
Method | Substitution_allele |