WormBase Tree Display for Variation: WBVar00275068
expand all nodes | collapse all nodes | view schema
WBVar00275068 | Name | Public_name | vs24 | ||||
---|---|---|---|---|---|---|---|
Other_name | CE38269:p.Asn591Ile | ||||||
C09E10.2e.1:c.2141A>T | |||||||
C09E10.2d.1:c.1772A>T | |||||||
C09E10.2b.1:c.2240A>T | |||||||
CE08038:p.Asn745Ile | |||||||
C09E10.2c.1:c.1766A>T | |||||||
CE08039:p.Asn747Ile | |||||||
CE38268:p.Asn589Ile | |||||||
CE38270:p.Asn714Ile | |||||||
C09E10.2a.1:c.2234A>T | |||||||
HGVSg | CHROMOSOME_X:g.986105T>A | ||||||
Sequence_details | SMap | S_parent | Sequence | C09E10 | |||
Flanking_sequences | tgaagtccaatttttgcatattgtgttttg | taaatagtcgagattggaatttttccggat | |||||
Mapping_target | C09E10 | ||||||
Type_of_mutation | Substitution | t | a | Curator_confirmed | WBPerson4055 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Laboratory | LX | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00000958 | |||||
Transcript | C09E10.2d.1 (12) | ||||||
C09E10.2c.1 (12) | |||||||
C09E10.2a.1 (12) | |||||||
C09E10.2e.1 (12) | |||||||
C09E10.2b.1 (12) | |||||||
Genetics | Interpolated_map_position | X | -18.8717 | ||||
Remark | This allele contains two substitution mutations. In addition to the N(745) aac to atc mutation there is also a silent mutation at 750 of gca to gcg which has flanking sequences of atctcgactatttaacaaaacacaatatgc and aaaattggacttcagaaaatgttcttcgaa. | Paper_evidence | WBPaper00024616 | ||||
Variation flanks and nucleotide change automatically updated to be on the positive strand to fix mapping and gff dumping issues. | |||||||
[200224 mh6] reverse complemented/swapped the change and flanks to move the variation onto the plus strand | Curator_confirmed | WBPerson4055 | |||||
Method | Substitution_allele |