WormBase Tree Display for Variation: WBVar00274922
expand all nodes | collapse all nodes | view schema
| WBVar00274922 | Evidence | Paper_evidence | WBPaper00035146 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | ur304 | |||||
| Other_name | T19B4.7.1:c.3167C>T | ||||||
| CE25115:p.Ala1056Val | |||||||
| HGVSg | CHROMOSOME_I:g.5682728G>A | ||||||
| Sequence_details | SMap | S_parent | Sequence | T19B4 | |||
| Flanking_sequences | gctattctatcaggaaaagatcgtcacaatg | acgtgggcatggatcagcggcttctggcgat | |||||
| Mapping_target | T19B4 | ||||||
| Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00035146 | ||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain (23) | |||||||
| Laboratory | IM | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00006776 | |||||
| Transcript | T19B4.7.1 (12) | ||||||
| Interactor (14) | |||||||
| Genetics | Interpolated_map_position | I | 0.308076 | ||||
| Description | Phenotype_not_observed | WBPhenotype:0000104 | Paper_evidence | WBPaper00035146 | |||
| Curator_confirmed | WBPerson2021 | ||||||
| Remark | The unc-40(ur304) mutation does not alter the asymmetric localization of UNC-40 | Paper_evidence | WBPaper00035146 | ||||
| Curator_confirmed | WBPerson2021 | ||||||
| WBPhenotype:0000384 | Paper_evidence | WBPaper00035146 | |||||
| Curator_confirmed | WBPerson2021 | ||||||
| Remark | The unc-40(ur304) mutation does not cause cell or axon migration defects | Paper_evidence | WBPaper00035146 | ||||
| Curator_confirmed | WBPerson2021 | ||||||
| WBPhenotype:0000594 | Paper_evidence | WBPaper00035146 | |||||
| Curator_confirmed | WBPerson2021 | ||||||
| Remark | The unc-40(ur304) mutation does not cause cell or axon migration defects | Paper_evidence | WBPaper00035146 | ||||
| Curator_confirmed | WBPerson2021 | ||||||
| WBPhenotype:0000679 | Paper_evidence | WBPaper00035146 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | UNC-40::GFP is ventrally localized as in wild type animals. | Paper_evidence | WBPaper00035146 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| WBPhenotype:0000886 | Paper_evidence | WBPaper00035146 | |||||
| Curator_confirmed | WBPerson2021 | ||||||
| Remark | The unc-40(ur304) mutation itself does not produce a visible phenotype. | Paper_evidence | WBPaper00035146 | ||||
| Curator_confirmed | WBPerson2021 | ||||||
| Reference | WBPaper00035146 | ||||||
| Method | Substitution_allele |
