WormBase Tree Display for Variation: WBVar00266636
expand all nodes | collapse all nodes | view schema
WBVar00266636 | Evidence | Paper_evidence | WBPaper00030754 | |||||
---|---|---|---|---|---|---|---|---|
Name (3) | ||||||||
Sequence_details | SMap | S_parent | Sequence | ZK897 | ||||
Flanking_sequences | gatgacgaaaatgagcgacatctatgggtc | aggctctgtaccgagccacaggtcaagcct | ||||||
Mapping_target | ZK897 | |||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00030754 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | TU | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00006767 | ||||||
Transcript | ZK897.1c.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | |||||||
HGVSc | ZK897.1c.1:c.2002C>T | |||||||
HGVSp | CE44563:p.Gln668Ter | |||||||
cDNA_position | 2002 | |||||||
CDS_position | 2002 | |||||||
Protein_position | 668 | |||||||
Exon_number | 11/21 | |||||||
Codon_change | Cag/Tag | |||||||
Amino_acid_change | Q/* | |||||||
ZK897.1p.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | ZK897.1p.1:c.2023C>T | |||||||
HGVSp | CE49853:p.Gln675Ter | |||||||
cDNA_position | 2023 | |||||||
CDS_position | 2023 | |||||||
Protein_position | 675 | |||||||
Exon_number | 12/22 | |||||||
Codon_change | Cag/Tag | |||||||
Amino_acid_change | Q/* | |||||||
ZK897.1q.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | ZK897.1q.1:c.2002C>T | |||||||
HGVSp | CE49778:p.Gln668Ter | |||||||
cDNA_position | 2002 | |||||||
CDS_position | 2002 | |||||||
Protein_position | 668 | |||||||
Exon_number | 11/21 | |||||||
Codon_change | Cag/Tag | |||||||
Amino_acid_change | Q/* | |||||||
ZK897.1o.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | ZK897.1o.1:c.2002C>T | |||||||
HGVSp | CE49924:p.Gln668Ter | |||||||
cDNA_position | 2002 | |||||||
CDS_position | 2002 | |||||||
Protein_position | 668 | |||||||
Exon_number | 11/20 | |||||||
Codon_change | Cag/Tag | |||||||
Amino_acid_change | Q/* | |||||||
ZK897.1s.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | ZK897.1s.1:c.658C>T | |||||||
HGVSp | CE49876:p.Gln220Ter | |||||||
cDNA_position | 658 | |||||||
CDS_position | 658 | |||||||
Protein_position | 220 | |||||||
Exon_number | 4/14 | |||||||
Codon_change | Cag/Tag | |||||||
Amino_acid_change | Q/* | |||||||
ZK897.1a.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | ZK897.1a.1:c.2038C>T | |||||||
HGVSp | CE44675:p.Gln680Ter | |||||||
cDNA_position | 2057 | |||||||
CDS_position | 2038 | |||||||
Protein_position | 680 | |||||||
Exon_number | 13/22 | |||||||
Codon_change | Cag/Tag | |||||||
Amino_acid_change | Q/* | |||||||
ZK897.1l.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | ZK897.1l.1:c.2038C>T | |||||||
HGVSp | CE49750:p.Gln680Ter | |||||||
cDNA_position | 2038 | |||||||
CDS_position | 2038 | |||||||
Protein_position | 680 | |||||||
Exon_number | 12/22 | |||||||
Codon_change | Cag/Tag | |||||||
Amino_acid_change | Q/* | |||||||
ZK897.1k.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | ZK897.1k.1:c.2059C>T | |||||||
HGVSp | CE49815:p.Gln687Ter | |||||||
cDNA_position | 2059 | |||||||
CDS_position | 2059 | |||||||
Protein_position | 687 | |||||||
Exon_number | 13/22 | |||||||
Codon_change | Cag/Tag | |||||||
Amino_acid_change | Q/* | |||||||
ZK897.1d.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | ZK897.1d.1:c.658C>T | |||||||
HGVSp | CE44694:p.Gln220Ter | |||||||
cDNA_position | 658 | |||||||
CDS_position | 658 | |||||||
Protein_position | 220 | |||||||
Exon_number | 4/12 | |||||||
Codon_change | Cag/Tag | |||||||
Amino_acid_change | Q/* | |||||||
ZK897.1e.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | ZK897.1e.1:c.658C>T | |||||||
HGVSp | CE44651:p.Gln220Ter | |||||||
cDNA_position | 658 | |||||||
CDS_position | 658 | |||||||
Protein_position | 220 | |||||||
Exon_number | 4/13 | |||||||
Codon_change | Cag/Tag | |||||||
Amino_acid_change | Q/* | |||||||
ZK897.1i.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | ZK897.1i.1:c.2023C>T | |||||||
HGVSp | CE47452:p.Gln675Ter | |||||||
cDNA_position | 2023 | |||||||
CDS_position | 2023 | |||||||
Protein_position | 675 | |||||||
Exon_number | 12/21 | |||||||
Codon_change | Cag/Tag | |||||||
Amino_acid_change | Q/* | |||||||
ZK897.1n.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | ZK897.1n.1:c.2002C>T | |||||||
HGVSp | CE49928:p.Gln668Ter | |||||||
cDNA_position | 2002 | |||||||
CDS_position | 2002 | |||||||
Protein_position | 668 | |||||||
Exon_number | 11/21 | |||||||
Codon_change | Cag/Tag | |||||||
Amino_acid_change | Q/* | |||||||
ZK897.1h.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | ZK897.1h.1:c.1966C>T | |||||||
HGVSp | CE47155:p.Gln656Ter | |||||||
cDNA_position | 1966 | |||||||
CDS_position | 1966 | |||||||
Protein_position | 656 | |||||||
Exon_number | 10/19 | |||||||
Codon_change | Cag/Tag | |||||||
Amino_acid_change | Q/* | |||||||
ZK897.1b.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | ZK897.1b.1:c.2002C>T | |||||||
HGVSp | CE44637:p.Gln668Ter | |||||||
cDNA_position | 2021 | |||||||
CDS_position | 2002 | |||||||
Protein_position | 668 | |||||||
Exon_number | 12/20 | |||||||
Codon_change | Cag/Tag | |||||||
Amino_acid_change | Q/* | |||||||
ZK897.1j.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | ZK897.1j.1:c.2059C>T | |||||||
HGVSp | CE49911:p.Gln687Ter | |||||||
cDNA_position | 2059 | |||||||
CDS_position | 2059 | |||||||
Protein_position | 687 | |||||||
Exon_number | 13/23 | |||||||
Codon_change | Cag/Tag | |||||||
Amino_acid_change | Q/* | |||||||
ZK897.1m.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | ZK897.1m.1:c.2038C>T | |||||||
HGVSp | CE49941:p.Gln680Ter | |||||||
cDNA_position | 2038 | |||||||
CDS_position | 2038 | |||||||
Protein_position | 680 | |||||||
Exon_number | 12/21 | |||||||
Codon_change | Cag/Tag | |||||||
Amino_acid_change | Q/* | |||||||
ZK897.1r.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | ZK897.1r.1:c.1966C>T | |||||||
HGVSp | CE49966:p.Gln656Ter | |||||||
cDNA_position | 1966 | |||||||
CDS_position | 1966 | |||||||
Protein_position | 656 | |||||||
Exon_number | 10/20 | |||||||
Codon_change | Cag/Tag | |||||||
Amino_acid_change | Q/* | |||||||
Genetics | Interpolated_map_position | IV | 6.32069 | |||||
Description | Phenotype | WBPhenotype:0000204 | Paper_evidence | WBPaper00030754 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | aBoc is executed ~50% of the time. | Paper_evidence | WBPaper00030754 | |||||
Curator_confirmed | WBPerson712 | |||||||
Penetrance | Incomplete | 50 | Paper_evidence | WBPaper00030754 | ||||
Curator_confirmed | WBPerson712 | |||||||
Semi_dominant | Paper_evidence | WBPaper00030754 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00030754 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000391 | Paper_evidence | WBPaper00030754 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Emc precedes aBoc 75% of the time. | Paper_evidence | WBPaper00030754 | |||||
Curator_confirmed | WBPerson712 | |||||||
Penetrance | Incomplete | 75 | Paper_evidence | WBPaper00030754 | ||||
Curator_confirmed | WBPerson712 | |||||||
Recessive | Paper_evidence | WBPaper00030754 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00030754 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000644 | Paper_evidence | WBPaper00030754 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Contains the same amber suppressible mutation as e375 and e69. | Paper_evidence | WBPaper00030754 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001410 | Paper_evidence | WBPaper00030754 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | As determined by a lack of signal on Western blots probed with an antibody corresponding to amino acids 42-304 of UNC-31. | Paper_evidence | WBPaper00030754 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00030754 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001426 | Paper_evidence | WBPaper00030754 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | As assayed by ANF::GFP fluorescence accumulation in coelomocytes | Paper_evidence | WBPaper00030754 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00030754 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | EG3682 unc-31(u280) oxIs206[Paex-3:ANF::GFP] | Paper_evidence | WBPaper00030754 | ||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed | WBPhenotype:0000604 | Paper_evidence | WBPaper00030754 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Mutants exhibit the correct specification, number and position of cell bodies of the GABAergic nervous system. | Paper_evidence | WBPaper00030754 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00030754 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | EG1846 unc-31(u280); oxIs12[Punc-47:GFP] | Paper_evidence | WBPaper00030754 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000616 | Paper_evidence | WBPaper00030754 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | The number of synaptic densities in dorsal nerve cord cholinergic neurons of unc-31 mutants is similar to that in wild-type animals. | Paper_evidence | WBPaper00030754 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00030754 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | Not stated | Paper_evidence | WBPaper00030754 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000625 | Paper_evidence | WBPaper00030754 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | The density and distribution of tagged Synaptobrevin in GABA neurons is normal. | Paper_evidence | WBPaper00030754 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00030754 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | EG1485 unc-31(u280) nIs52[Punc-25:SNB-1::GFP;lin-15(+)] | Paper_evidence | WBPaper00030754 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001224 | Paper_evidence | WBPaper00030754 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | No gross defects were observed in the number of GABA commissures or in GABA axon projection. | Paper_evidence | WBPaper00030754 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00030754 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | EG1846 unc-31(u280); oxIs12[Punc-47:GFP] | Paper_evidence | WBPaper00030754 | ||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00015225 | |||||||
WBPaper00017299 | ||||||||
WBPaper00030754 | ||||||||
WBPaper00048388 | ||||||||
Method | Substitution_allele |