WormBase Tree Display for Variation: WBVar00266514
expand all nodes | collapse all nodes | view schema
WBVar00266514 | Evidence | Paper_evidence | WBPaper00003969 | ||
---|---|---|---|---|---|
Name | Public_name | u51 | |||
Other_name | T01C8.7.1:c.1184C>T | ||||
CE39109:p.Pro395Leu | |||||
HGVSg | CHROMOSOME_X:g.16805159G>A | ||||
Sequence_details | SMap | S_parent | Sequence | T01C8 | |
Flanking_sequences | aaatttggacatatcttcaaggaggaactc | aactgaagatccaaacttccttgaagctat | |||
Mapping_target | T01C8 | ||||
Type_of_mutation | Substitution | c | t | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Laboratory | TU | ||||
Status | Live | ||||
Affects | Gene | WBGene00003168 | |||
Transcript | T01C8.7.1 (12) | ||||
Isolation | Mutagen | EMS | Paper_evidence | WBPaper00003969 | |
Genetics | Interpolated_map_position | X | 24.0629 | ||
Reference | WBPaper00003969 | ||||
Remark | In addition to the curated lesion, u51 also carries a G->A substitution with flanking sequences of gtataaaccaaaaaacgtgttccgattcca & gtcccatgtacggattacgtatgctggttt giving rise to an acceptor splice site mutation | Paper_evidence | WBPaper00003969 | ||
Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00003168 Missense 395 P to L | Paper_evidence | WBPaper00003969 | |||
Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00003168 Acceptor aggt -> aagt | |||||
Method | Substitution_allele |