WormBase Tree Display for Variation: WBVar00266484
expand all nodes | collapse all nodes | view schema
WBVar00266484 | Evidence | Paper_evidence | WBPaper00005563 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | tz2 | |||||||
Other_name | Y41C4A.4a.1:c.858+3_*101del | ||||||||
Y41C4A.4g.1:c.1167+3_*101del | |||||||||
Y41C4A.4e.1:c.801+3_*101del | |||||||||
Y41C4A.4d.1:c.876+3_*101del | |||||||||
Y41C4A.4f.1:c.450+3_*101del | |||||||||
HGVSg | CHROMOSOME_III:g.11692677_11693655del | ||||||||
Sequence_details | SMap | S_parent | Sequence | Y41C4A | |||||
Flanking_sequences | agcgaaagagtgccgcagaaaaaagaaggt | atttcctaatttttgaaagaaaaaaaattg | |||||||
Mapping_target | Y41C4A | ||||||||
Type_of_mutation | Deletion | ||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00040751 | ||||||||
WBStrain00047812 | |||||||||
Laboratory | YT | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00000793 | |||||||
Transcript | Y41C4A.4e.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | Y41C4A.4e.1:c.801+3_*101del | ||||||||
cDNA_position | ?-1082 | ||||||||
Intron_number | 7/8 | ||||||||
Exon_number | 8-9/9 | ||||||||
Y41C4A.4g.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | Y41C4A.4g.1:c.1167+3_*101del | ||||||||
cDNA_position | ?-1388 | ||||||||
Intron_number | 5/6 | ||||||||
Exon_number | 6-7/7 | ||||||||
Y41C4A.4b.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
Intron_number | 6/6 | ||||||||
Exon_number | 7/7 | ||||||||
Y41C4A.4a.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | Y41C4A.4a.1:c.858+3_*101del | ||||||||
cDNA_position | ?-1181 | ||||||||
Intron_number | 7/8 | ||||||||
Exon_number | 8-9/9 | ||||||||
Y41C4A.4d.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | Y41C4A.4d.1:c.876+3_*101del | ||||||||
cDNA_position | ?-1197 | ||||||||
Intron_number | 7/8 | ||||||||
Exon_number | 8-9/9 | ||||||||
Y41C4A.4f.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | Y41C4A.4f.1:c.450+3_*101del | ||||||||
cDNA_position | ?-937 | ||||||||
Intron_number | 4/5 | ||||||||
Exon_number | 5-6/6 | ||||||||
Y41C4A.4c.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
Intron_number | 6/6 | ||||||||
Exon_number | 7/7 | ||||||||
Interactor | WBInteraction000546931 | ||||||||
Genetics | Interpolated_map_position | III | 11.7926 | ||||||
Description | Phenotype | WBPhenotype:0000478 | Paper_evidence | WBPaper00039855 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 17 deg C-cultivated crh-1(tz2) mutants migrated to colder regions; this behavior is similar wild-type animals; however, 23 and 20 deg C-cultivated crh-1(tz2) animals migrated towards colder regions than wild-type animals. | Expression of CRH-1 in AFD restores the behavioural defect of crh-1(tz2) mutants. | Paper_evidence | WBPaper00039855 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000997 | Paper_evidence | WBPaper00039855 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 17 deg C-cultivated crh-1(tz2) mutants migrated to colder regions; this behavior is similar wild-type animals; however, 23 and 20 deg C-cultivated crh-1(tz2) animals migrated towards colder regions than wild-type animals. | Expression of CRH-1 in AFD restores the behavioural defect of crh-1(tz2) mutants. | Paper_evidence | WBPaper00039855 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000999 | Paper_evidence | WBPaper00039855 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 17 deg C-cultivated crh-1(tz2) mutants migrated to colder regions; this behavior is similar wild-type animals; however, 23 and 20 deg C-cultivated crh-1(tz2) animals migrated towards colder regions than wild-type animals. | Expression of CRH-1 in AFD restores the behavioural defect of crh-1(tz2) mutants. | Paper_evidence | WBPaper00039855 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001236 | Paper_evidence | WBPaper00049891 | |||||||
Curator_confirmed | WBPerson10038 | ||||||||
Remark | Quoted from paper: "We found that fluorescence of the glr-1 transcriptional reporter was increased in crh-1(tz2) loss-of-function mutants (Fig 3F), consistent with a role for CREB as a downstream target of CMK-1 in regulating glr-1transcription." | Paper_evidence | WBPaper00049891 | ||||||
Curator_confirmed | WBPerson10038 | ||||||||
Phenotype_assay | Strain | WBStrain00047812 | Paper_evidence | WBPaper00049891 | |||||
Curator_confirmed | WBPerson10038 | ||||||||
Control_strain | WBStrain00047313 | Paper_evidence | WBPaper00049891 | ||||||
Curator_confirmed | WBPerson10038 | ||||||||
Genotype | pzIs29 [Pglr-1::NLS-GFP::LacZ::unc-54 3'UTR] | Paper_evidence | WBPaper00049891 | ||||||
Curator_confirmed | WBPerson10038 | ||||||||
WBPhenotype:0001785 | Paper_evidence | WBPaper00046360 | |||||||
WBPaper00040253 | |||||||||
Curator_confirmed | WBPerson3142 | ||||||||
WBPerson1251 | |||||||||
WBPhenotype:0002199 | Paper_evidence | WBPaper00039855 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | AFD neurons exhibit attenuation of calcium-concentration changes when cultivated at 20 and 23 deg C; the magnitude of calcium-concentration changes of AFD neurons in crh-1(tz2) mutants is significantly lower than that in wild-type animals. | Paper_evidence | WBPaper00039855 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002469 | Paper_evidence | WBPaper00039821 | |||||||
Curator_confirmed | WBPerson5364 | ||||||||
Remark | Figure 2, crh-1(tz2) mutant worms fail to form long-term memory of habituation training. Figure 4, rescuing crh-1(+) in the MAGI-1, but not MEC-4, expressing neurons rescues the long-term memory defects of crh-1(tz2) mutant worms. | Paper_evidence | WBPaper00039821 | ||||||
Curator_confirmed | WBPerson5364 | ||||||||
WBPhenotype:0002567 | Paper_evidence | WBPaper00036296 | |||||||
Curator_confirmed | WBPerson3142 | ||||||||
Remark | The cmk-1:crh-1β transgene rescues the long-term associative olfactory memory defect of crh-1(tz2) (Figure 3C) | Paper_evidence | WBPaper00036296 | ||||||
Curator_confirmed | WBPerson3142 | ||||||||
Rescued_by_transgene | WBTransgene00026445 | ||||||||
WBPhenotype:0002568 | Paper_evidence | WBPaper00041586 | |||||||
Curator_confirmed | WBPerson10038 | ||||||||
Remark | Table 1. Quoted from paper "crh-1 is required for long-term but not short-term memory for both associative and non-associative memory." | Paper_evidence | WBPaper00041586 | ||||||
Curator_confirmed | WBPerson10038 | ||||||||
Phenotype_assay | Control_strain | WBStrain00000001 | Paper_evidence | WBPaper00041586 | |||||
Curator_confirmed | WBPerson10038 | ||||||||
WBPhenotype:0002599 | Paper_evidence | WBPaper00041586 | |||||||
Curator_confirmed | WBPerson10038 | ||||||||
Remark | Table 1. Quoted from paper "crh-1 is required for long-term but not short-term memory for both associative and non-associative memory." | Paper_evidence | WBPaper00041586 | ||||||
Curator_confirmed | WBPerson10038 | ||||||||
Phenotype_assay | Control_strain | WBStrain00000001 | Paper_evidence | WBPaper00041586 | |||||
Curator_confirmed | WBPerson10038 | ||||||||
Phenotype_not_observed | WBPhenotype:0002199 | Paper_evidence | WBPaper00049050 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "However, neither crh-1 mutants that lacked a C. elegans CREB homolog (Nishida et al., 2011) nor unc-43 mutants that lacked the C. elegans CaMKII ortholog (Reiner et al., 1999) showed a severe defect in the variable calcium response of AFD (Figure S2B)." | Paper_evidence | WBPaper00049050 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005662 | PATO:0000460 | Paper_evidence | WBPaper00049050 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | njIs24[gcy-8p::GCaMP3, gcy-8p::TagRFP] (I); Parent strain: IK0972 | Paper_evidence | WBPaper00049050 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002469 | Paper_evidence | WBPaper00039821 | |||||||
Curator_confirmed | WBPerson5364 | ||||||||
Remark | Figure 1, crh-1(tz2) mutant worms can habituate to repeated mechanosensory (tap) stimuli | Paper_evidence | WBPaper00039821 | ||||||
Curator_confirmed | WBPerson5364 | ||||||||
Reference | WBPaper00039821 | ||||||||
WBPaper00039855 | |||||||||
WBPaper00040253 | |||||||||
WBPaper00010064 | |||||||||
WBPaper00005563 | |||||||||
WBPaper00036296 | |||||||||
WBPaper00046360 | |||||||||
WBPaper00049050 | |||||||||
WBPaper00041586 | |||||||||
WBPaper00049891 | |||||||||
Method | Deletion_allele |