WormBase Tree Display for Variation: WBVar00266473
expand all nodes | collapse all nodes | view schema
WBVar00266473 | Evidence | Paper_evidence | WBPaper00006130 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | tx12 | |||||
Other_name | ZC404.3a.1:c.637-1G>A | ||||||
ZC404.3b.2:c.*375-1G>A | |||||||
ZC404.3b.1:c.*375-1G>A | |||||||
HGVSg | CHROMOSOME_V:g.6786438G>A | ||||||
Sequence_details | SMap | S_parent | Sequence | ZC404 | |||
Flanking_sequences | taattttttaaaaagttatctttctttaca | attgtgatttttctagagagaactctcaag | |||||
Mapping_target | ZC404 | ||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00006130 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00034096 | ||||||
Laboratory | DS | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00004975 | |||||
Transcript | ZC404.3b.1 | VEP_consequence | splice_acceptor_variant | ||||
VEP_impact | HIGH | ||||||
HGVSc | ZC404.3b.1:c.*375-1G>A | ||||||
Intron_number | 6/10 | ||||||
ZC404.3a.1 | VEP_consequence | splice_acceptor_variant | |||||
VEP_impact | HIGH | ||||||
HGVSc | ZC404.3a.1:c.637-1G>A | ||||||
Intron_number | 5/10 | ||||||
ZC404.3b.2 | VEP_consequence | splice_acceptor_variant | |||||
VEP_impact | HIGH | ||||||
HGVSc | ZC404.3b.2:c.*375-1G>A | ||||||
Intron_number | 6/9 | ||||||
Genetics | Interpolated_map_position | V | 0.2544 | ||||
Reference | WBPaper00006130 | ||||||
Remark | tx12 mutates the acceptor of the 5th exon | Paper_evidence | WBPaper00006130 | ||||
Method | Substitution_allele |