WormBase Tree Display for Variation: WBVar00264011
expand all nodes | collapse all nodes | view schema
| WBVar00264011 | Name | Public_name | ttTi41084 | |||
|---|---|---|---|---|---|---|
| Sequence_details | SMap | S_parent | Sequence | T06A1 | ||
| Flanking_sequences | GTGAATGGAGAGCCTGCATTGGCATATTTT | AGAAAACTCTCCGGTTCTGTAAATGGATTT | ||||
| Mapping_target | T06A1 | |||||
| Type_of_mutation | Insertion | |||||
| SeqStatus | Sequenced | |||||
| Variation_type | Allele | |||||
| Transposon_insertion | Mos | |||||
| Origin | Species | Caenorhabditis elegans | ||||
| Strain | WBStrain00019501 | |||||
| Laboratory | IE | |||||
| Person | WBPerson6564 | |||||
| DB_info | Database | NemaGENETAG_Consortium | allele_name | ttTi41084 | ||
| NemaGENETAG_consortium_allele | ||||||
| Status | Live | |||||
| Affects | Gene | WBGene00020280 | ||||
| Transcript | T06A1.5.1 | |||||
| Reference | WBPaper00040752 | |||||
| WBPaper00028894 | ||||||
| WBPaper00033043 | ||||||
| Remark | [20060613 ls] the TA insertion site may be +/- 10bp from this location | |||||
| [20060613 ls] the right side of Mos is facing the left of the sequence | ||||||
| [20060613 ls] this MOS insertion generated thanks to a grant of the European Union (project NEMAGENETAG) | ||||||
| For further information and strain requests please visit http://ums3421.univ-lyon1.fr/ | ||||||
| Method | NemaGENETAG_consortium_allele |
