WormBase Tree Display for Variation: WBVar00257482
expand all nodes | collapse all nodes | view schema
WBVar00257482 | Name | Public_name | ttTi14384 | |||
---|---|---|---|---|---|---|
Sequence_details | SMap | S_parent | Sequence | K02C4 | ||
Flanking_sequences | GTCATTCCATTTTCAAAGATGCGAATGTTA | ATCGTCTTGATTTTTTTAATTCCACTAATT | ||||
Mapping_target | K02C4 | |||||
Type_of_mutation | Insertion | |||||
SeqStatus | Sequenced | |||||
Variation_type | Allele | |||||
Transposon_insertion | Mos | |||||
Origin | Species | Caenorhabditis elegans | ||||
Strain | WBStrain00012974 | |||||
Laboratory | IE | |||||
Person | WBPerson6564 | |||||
DB_info | Database | NemaGENETAG_Consortium | allele_name | ttTi14384 | ||
NemaGENETAG_consortium_allele | ||||||
Status | Live | |||||
Affects | Gene | WBGene00010501 | ||||
Transcript | K02C4.2.1 | |||||
Reference | WBPaper00040752 | |||||
WBPaper00028894 | ||||||
WBPaper00033043 | ||||||
Remark | [20060613 ls] the TA insertion site may be +/- 10bp from this location | |||||
[20060613 ls] the right side of Mos is facing the left of the sequence (to be confirmed). | ||||||
[20060613 ls] this MOS insertion generated thanks to a grant of the European Union (project NEMAGENETAG) | ||||||
For further information and strain requests please visit http://ums3421.univ-lyon1.fr/ | ||||||
Method | NemaGENETAG_consortium_allele |