WormBase Tree Display for Variation: WBVar00253026
expand all nodes | collapse all nodes | view schema
WBVar00253026 | Name | Public_name | tm4650 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | C32C4.5a.1:c.367-18_*101del | |||||||
HGVSg | CHROMOSOME_V:g.10635232_10635512del | |||||||
Sequence_details | SMap | S_parent | Sequence | C32C4 | ||||
Flanking_sequences | atccaaaaaaaacacactgtttcccatttc | gagattttgctgtcatacgctttcaattac | ||||||
Mapping_target | C32C4 | |||||||
Source_location | 7 | CHROMOSOME_V | 10635231 | 10635513 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm4650_external | |||||||
tm4650_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 4650 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00003114 | ||||||
Transcript | C32C4.5b.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
Intron_number | 1/1 | |||||||
Exon_number | 2/2 | |||||||
C32C4.5a.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | C32C4.5a.1:c.367-18_*101del | |||||||
cDNA_position | ?-629 | |||||||
Intron_number | 4/5 | |||||||
Exon_number | 5-6/6 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | V | ||||||
Description | Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | 11764/11765-12045/12046 (281 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |