WormBase Tree Display for Variation: WBVar00252482
expand all nodes | collapse all nodes | view schema
WBVar00252482 | Name | Public_name | tm3898 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | Y53F4B.4a.1:c.201+257_369del | |||||||
Y53F4B.4b.1:c.663+257_831del | ||||||||
Y53F4B.4c.1:c.471+257_639del | ||||||||
Y53F4B.4a.2:c.201+257_369del | ||||||||
Y53F4B.4a.3:c.201+257_369del | ||||||||
HGVSg | CHROMOSOME_II:g.14973910_14974837del | |||||||
Sequence_details | SMap | S_parent | Sequence | Y53F4B | ||||
Flanking_sequences | cacatttttgtctcgaaaattcgaattttg | ctccttgacgcctcgaaagtcgcaatcgcc | ||||||
Mapping_target | Y53F4B | |||||||
Source_location | 7 | CHROMOSOME_II | 14973909 | 14974838 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm3898_external | |||||||
tm3898_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00022241 | |||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 3898 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects (2) | ||||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | II | ||||||
Description | Phenotype | WBPhenotype:0000061 | Paper_evidence | WBPaper00046466 | ||||
Curator_confirmed | WBPerson29150 | |||||||
Remark | only upon dietary restriction, Supplementary Figure 6 | Paper_evidence | WBPaper00046466 | |||||
Curator_confirmed | WBPerson29150 | |||||||
WBPhenotype:0000461 | Paper_evidence | WBPaper00046466 | ||||||
Curator_confirmed | WBPerson29150 | |||||||
Remark | Figure 3 | Paper_evidence | WBPaper00046466 | |||||
Curator_confirmed | WBPerson29150 | |||||||
WBPhenotype:0002466 | Paper_evidence | WBPaper00046466 | ||||||
Curator_confirmed | WBPerson29150 | |||||||
Remark | lack of m5C methylation at C2381 of 25S ribosomal RNA | Paper_evidence | WBPaper00046466 | |||||
Curator_confirmed | WBPerson29150 | |||||||
Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00046466 | ||||||
Curator_confirmed | WBPerson29150 | |||||||
Remark | Supplementary Figure 4 | Paper_evidence | WBPaper00046466 | |||||
Curator_confirmed | WBPerson29150 | |||||||
WBPhenotype:0000750 | Person_evidence | WBPerson29150 | ||||||
Curator_confirmed | WBPerson29150 | |||||||
WBPhenotype:0001006 | Paper_evidence | WBPaper00046466 | ||||||
Curator_confirmed | WBPerson29150 | |||||||
Remark | Supplementary Figure 4 | Paper_evidence | WBPaper00046466 | |||||
Curator_confirmed | WBPerson29150 | |||||||
WBPhenotype:0001726 | Paper_evidence | WBPaper00046466 | ||||||
Curator_confirmed | WBPerson29150 | |||||||
Remark | Supplementary Figure 4 | Paper_evidence | WBPaper00046466 | |||||
Curator_confirmed | WBPerson29150 | |||||||
Reference | WBPaper00046466 | |||||||
Remark | 22761/22762-23689/23690 (928 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |