WormBase Tree Display for Variation: WBVar00252133

WBVar00252133 Name: Public_name: tm3456
    Other_name: F43G9.10.1:c.158_849del
      CE10372:p.Ala53AspfsTer6
    HGVSg: CHROMOSOME_I:g.8639333_8640078del
  Sequence_details: SMap: S_parent: Sequence: F43G9
    Flanking_sequences: aacagatgacaaatcaacacgatcttctgt cctttccagccacatatcttgaaactttca
    Mapping_target: F43G9
    Source_location: 7 CHROMOSOME_I 8639332 8640079 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm3456_external
      tm3456_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 3456
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00009671
    Transcript: F43G9.10.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description: Phenotype: WBPhenotype:0000050 Paper_evidence: WBPaper00041328
        Curator_confirmed: WBPerson2495
      WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal or sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal or sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Reference: WBPaper00041328
  Remark: 34173/34174-34919/34920 (746 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele