WormBase Tree Display for Variation: WBVar00252098

WBVar00252098 Name: Public_name: tm3410
    Other_name: Y32H12A.5.1:c.627_990delinsTTTTTC
      CE35070:p.Glu210PhefsTer4
    HGVSg: CHROMOSOME_III:g.5377183_5377954delinsGAAAAA
  Sequence_details: SMap: S_parent: Sequence: Y32H12A
    Flanking_sequences: ttgcatttgatcatggggacgagtcagaaa tgtccccgacgttgtggatgtaatttgtat
    Mapping_target: Y32H12A
    Source_location: 7 CHROMOSOME_III 5377182 5377955 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: GAAAAA
      Deletion
    PCR_product: tm3410_external
      tm3410_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain (13)
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 3410
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00021313
    Transcript: Y32H12A.5.1 (11)
    Interactor (29)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: III
  Description: Phenotype (18)
    Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National BioResource Project of Japan. Originally classified as lethal OR sterile by the NBP. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000134 Paper_evidence: WBPaper00049467
        Curator_confirmed: WBPerson712
        Remark: Expression of the pIGLR-2::GFP reporter is the same in wild-type and paqr-2 mutant worms. Paper_evidence: WBPaper00049467
            Curator_confirmed: WBPerson712
      WBPhenotype:0000138 Paper_evidence: WBPaper00039827
        Curator_confirmed: WBPerson712
        Remark: none of the single mutants showed a significant difference in their lipid content compared to wild type Paper_evidence: WBPaper00039827
            Curator_confirmed: WBPerson712
        Phenotype_assay: Genotype: daf-2(e1370) Paper_evidence: WBPaper00039827
              Curator_confirmed: WBPerson712
      WBPhenotype:0000308 Paper_evidence: WBPaper00039827
        Curator_confirmed: WBPerson712
        Remark: animals do not show any defects in entry or exit from dauer Paper_evidence: WBPaper00039827
            Curator_confirmed: WBPerson712
        Phenotype_assay: Genotype: daf-2(e1370) Paper_evidence: WBPaper00039827
              Curator_confirmed: WBPerson712
      WBPhenotype:0000679 Paper_evidence: WBPaper00039827
        Curator_confirmed: WBPerson712
        Remark: using a daf-16::gfp translational reporter, we saw no evidence of increased DAF-16 translocation to the nuclei in the paqr-2 mutant Paper_evidence: WBPaper00039827
            Curator_confirmed: WBPerson712
        Phenotype_assay: Genotype: [DAF-16::GFP] Paper_evidence: WBPaper00039827
              Curator_confirmed: WBPerson712
      WBPhenotype:0001453 Paper_evidence: WBPaper00039827
        Curator_confirmed: WBPerson712
        Remark: animals do not show any defects in high osmolarity avoidance behavior Paper_evidence: WBPaper00039827
            Curator_confirmed: WBPerson712
        Affected_by: Molecule: WBMol:00003571 Paper_evidence: WBPaper00039827
              Curator_confirmed: WBPerson712
      WBPhenotype:0001472 Paper_evidence: WBPaper00039827
        Curator_confirmed: WBPerson712
        Affected_by: Molecule: WBMol:00001063 Paper_evidence: WBPaper00039827
              Curator_confirmed: WBPerson712
  Reference: WBPaper00039827
    WBPaper00044247
    WBPaper00049467
    WBPaper00051473
    WBPaper00060877
    WBPaper00064979
    WBPaper00065845
    WBPaper00064731
  Remark: 30927/30928-GAAAAA-31699/31700 (772 bp deletion + 6 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele