WormBase Tree Display for Variation: WBVar00251912
expand all nodes | collapse all nodes | view schema
WBVar00251912 | Name | Public_name | tm3138 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | C46H11.11h.1:c.1641+166_1730delinsG | |||||||
C46H11.11g.1:c.1692+46_1781delinsG | ||||||||
C46H11.11d.1:c.687+46_776delinsG | ||||||||
C46H11.11e.1:c.1692+46_1781delinsG | ||||||||
C46H11.11c.1:c.687+46_776delinsG | ||||||||
C46H11.11b.1:c.636+166_725delinsG | ||||||||
C46H11.11f.1:c.1641+166_1730delinsG | ||||||||
C46H11.11a.1:c.636+166_725delinsG | ||||||||
HGVSg | CHROMOSOME_I:g.5063515_5064028delinsC | |||||||
Sequence_details | SMap | S_parent | Sequence | C30F8 | ||||
Flanking_sequences | agcttgtcccttcgacttgtcaacggtttg | aatttcgtgcacaatccacatgttgctttc | ||||||
Mapping_target | C30F8 | |||||||
Source_location | 7 | CHROMOSOME_I | 5063513 | 5064029 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Insertion | AC | ||||||
Deletion | ||||||||
PCR_product | tm3138_external | |||||||
tm3138_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 3138 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00016735 | ||||||
Transcript | C46H11.11g.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | C46H11.11g.1:c.1692+46_1781delinsG | |||||||
cDNA_position | ?-1782 | |||||||
CDS_position | ?-1782 | |||||||
Protein_position | ?-594 | |||||||
Intron_number | 5/15 | |||||||
Exon_number | 6/16 | |||||||
C46H11.11e.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | C46H11.11e.1:c.1692+46_1781delinsG | |||||||
cDNA_position | ?-1782 | |||||||
CDS_position | ?-1782 | |||||||
Protein_position | ?-594 | |||||||
Intron_number | 5/16 | |||||||
Exon_number | 6/17 | |||||||
C46H11.11f.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | C46H11.11f.1:c.1641+166_1730delinsG | |||||||
cDNA_position | ?-1735 | |||||||
CDS_position | ?-1731 | |||||||
Protein_position | ?-577 | |||||||
Intron_number | 5/16 | |||||||
Exon_number | 6/17 | |||||||
C46H11.11d.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | C46H11.11d.1:c.687+46_776delinsG | |||||||
cDNA_position | ?-780 | |||||||
CDS_position | ?-777 | |||||||
Protein_position | ?-259 | |||||||
Intron_number | 7/18 | |||||||
Exon_number | 8/19 | |||||||
C46H11.11b.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | C46H11.11b.1:c.636+166_725delinsG | |||||||
cDNA_position | ?-727 | |||||||
CDS_position | ?-726 | |||||||
Protein_position | ?-242 | |||||||
Intron_number | 6/17 | |||||||
Exon_number | 7/18 | |||||||
C46H11.11c.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | C46H11.11c.1:c.687+46_776delinsG | |||||||
cDNA_position | ?-777 | |||||||
CDS_position | ?-777 | |||||||
Protein_position | ?-259 | |||||||
Intron_number | 6/17 | |||||||
Exon_number | 7/18 | |||||||
C46H11.11h.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | C46H11.11h.1:c.1641+166_1730delinsG | |||||||
cDNA_position | ?-1731 | |||||||
CDS_position | ?-1731 | |||||||
Protein_position | ?-577 | |||||||
Intron_number | 4/14 | |||||||
Exon_number | 5/15 | |||||||
C46H11.11a.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | C46H11.11a.1:c.636+166_725delinsG | |||||||
cDNA_position | ?-727 | |||||||
CDS_position | ?-726 | |||||||
Protein_position | ?-242 | |||||||
Intron_number | 6/18 | |||||||
Exon_number | 7/19 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | I | ||||||
Description | Phenotype | WBPhenotype:0000087 | Paper_evidence | WBPaper00041258 | ||||
Curator_confirmed | WBPerson3809 | |||||||
Remark | thin body-wall muscle cells | Paper_evidence | WBPaper00041258 | |||||
Curator_confirmed | WBPerson3809 | |||||||
WBPhenotype:0000861 | Paper_evidence | WBPaper00041258 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Remark | In fhod-1(tm3138) mutants the dorsal and ventral pairs of body wall muscles have wider spaces between them than wild type. | Paper_evidence | WBPaper00041258 | |||||
Curator_confirmed | WBPerson557 | |||||||
Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
Reference | WBPaper00041258 | |||||||
Remark | 43758/43759-AC-44273/44274 (515 bp deletion + 2 bp insertion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Old Mapping_target C46H11 updated based on the VEP analysis pipeline to C30F8. | ||||||||
Method | NBP_knockout_allele |