WormBase Tree Display for Variation: WBVar00251556
expand all nodes | collapse all nodes | view schema
| WBVar00251556 | Name | Public_name | tm2711 | |||||
|---|---|---|---|---|---|---|---|---|
| Other_name | H02I12.8.1:c.265_650del | |||||||
| CE37719:p.Leu89Ter | ||||||||
| HGVSg | CHROMOSOME_IV:g.11404282_11404756del | |||||||
| Sequence_details | SMap | S_parent | Sequence | H02I12 | ||||
| Flanking_sequences | tttccatgtctgatgctctactctgccgat | taatccgttgatgtggaattcatttattta | ||||||
| Mapping_target | H02I12 | |||||||
| Source_location | 7 | CHROMOSOME_IV | 11404281 | 11404757 | Inferred_automatically | National_Bioresource_Project | ||
| Type_of_mutation | Deletion | |||||||
| PCR_product | tm2711_external | |||||||
| tm2711_internal | ||||||||
| SeqStatus | Sequenced | |||||||
| Variation_type | Allele | |||||||
| Origin | Species | Caenorhabditis elegans | ||||||
| Laboratory | FX | |||||||
| Author | Mitani S | |||||||
| DB_info | Database | National_Bioresource_Project | seq | 2711 | ||||
| NBP_allele | ||||||||
| Status | Live | |||||||
| Affects | Gene | WBGene00010354 | ||||||
| Transcript | H02I12.8.1 (11) | |||||||
| Isolation | Mutagen | TMP/UV | ||||||
| Genetics | Map | IV | ||||||
| Description | Phenotype | WBPhenotype:0000554 | Paper_evidence | WBPaper00033072 | ||||
| Curator_confirmed | WBPerson712 | |||||||
| Remark | Mutants showed a slight osmotic sensitivity when the eggs were laid on agarose prepared in dd water (hypoosmotic conditions) | Paper_evidence | WBPaper00033072 | |||||
| Curator_confirmed | WBPerson712 | |||||||
| Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | |||||
| Curator_confirmed | WBPerson712 | |||||||
| Remark | Classified as 'homozygous viable' by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
| Curator_confirmed | WBPerson712 | |||||||
| Laboratory_evidence | FX | |||||||
| WBPhenotype:0000520 | Paper_evidence | WBPaper00033072 | ||||||
| Curator_confirmed | WBPerson712 | |||||||
| Remark | Mutants displayed no obvious morphological phenotypes | Paper_evidence | WBPaper00033072 | |||||
| Curator_confirmed | WBPerson712 | |||||||
| WBPhenotype:0000749 | Paper_evidence | WBPaper00033072 | ||||||
| Curator_confirmed | WBPerson712 | |||||||
| Remark | Mutant embryos develop normally when laid on NGM agar | Paper_evidence | WBPaper00033072 | |||||
| Curator_confirmed | WBPerson712 | |||||||
| Disease_info | Models_disease | DOID:0050664 | ||||||
| Models_disease_in_annotation | WBDOannot00000111 | |||||||
| Reference | WBPaper00033072 | |||||||
| Remark | 32980/32981-33455/33456 (475 bp deletion) | |||||||
| This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
| Method | NBP_knockout_allele |
