WormBase Tree Display for Variation: WBVar00251454

WBVar00251454 Name: Public_name: tm2593
    Other_name: F07A5.1b.1:c.441_738delinsACAAA
      F07A5.1a.1:c.441_738delinsACAAA
      F07A5.1a.2:c.441_738delinsACAAA
      CE05554:p.Asn147LysfsTer29
      CE17632:p.Asn147LysfsTer29
    HGVSg: CHROMOSOME_I:g.7351174_7351543delinsTTTGT
  Sequence_details: SMap: S_parent: Sequence: F07A5
    Flanking_sequences: tgtgagaattgccgcgaatctttgtttgtc ttgatttttccagagtaatccacaatgaaa
    Mapping_target: F07A5
    Source_location: 7 CHROMOSOME_I 7351173 7351544 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: TTTGT
      Deletion
    PCR_product: tm2593_external
      tm2593_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 2593
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00002136
    Transcript: F07A5.1b.1 (11)
      F07A5.1a.2 (11)
      F07A5.1a.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Dr. D. Greenstein: Ste. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
    Phenotype_not_observed: WBPhenotype:0000643 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Comments to the National Bioresource Project of Japan: Dr. K. Subramaniam: normal locomotion. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
  Remark: 2319/2320-TTTGT-2689/2690 (370 bp deletion + 5 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele