WormBase Tree Display for Variation: WBVar00251384
expand all nodes | collapse all nodes | view schema
| WBVar00251384 | Name | Public_name | tm2510 | |||||
|---|---|---|---|---|---|---|---|---|
| Other_name | T01C2.1.1:c.201_400del | |||||||
| CE42417:p.Arg68IlefsTer6 | ||||||||
| HGVSg | CHROMOSOME_V:g.5629782_5630086del | |||||||
| Sequence_details | SMap | S_parent | Sequence | T01C2 | ||||
| Flanking_sequences | gttctgtccgtttagcatgaaaaaatgata | agcttttcccaaggaaagtggtagaacgag | ||||||
| Mapping_target | T01C2 | |||||||
| Source_location | 7 | CHROMOSOME_V | 5629781 | 5630087 | Inferred_automatically | National_Bioresource_Project | ||
| Type_of_mutation | Deletion | |||||||
| PCR_product | tm2510_external | |||||||
| tm2510_internal | ||||||||
| SeqStatus | Sequenced | |||||||
| Variation_type | Allele | |||||||
| Origin | Species | Caenorhabditis elegans | ||||||
| Laboratory | FX | |||||||
| Author | Mitani S | |||||||
| DB_info | Database | National_Bioresource_Project | seq | 2510 | ||||
| NBP_allele | ||||||||
| Status | Live | |||||||
| Affects | Gene | WBGene00000071 | ||||||
| Transcript | T01C2.1.1 (11) | |||||||
| Isolation | Mutagen | TMP/UV | ||||||
| Genetics | Map | V | ||||||
| Description | Phenotype | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||
| Curator_confirmed | WBPerson712 | |||||||
| Remark | Classified as lethal OR sterile by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
| Curator_confirmed | WBPerson712 | |||||||
| Laboratory_evidence | FX | |||||||
| WBPhenotype:0000105 | Person_evidence | WBPerson7743 | ||||||
| Curator_confirmed | WBPerson712 | |||||||
| Remark | Comments to the National Bioresource Project of Japan: Dr. D. Greenstein: Herm: defects in oocyte meiotic maturation, | Person_evidence | WBPerson7743 | |||||
| Curator_confirmed | WBPerson712 | |||||||
| Laboratory_evidence | FX | |||||||
| WBPhenotype:0000688 | Person_evidence | WBPerson7743 | ||||||
| Curator_confirmed | WBPerson712 | |||||||
| Remark | Classified as lethal OR sterile by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
| Curator_confirmed | WBPerson712 | |||||||
| Laboratory_evidence | FX | |||||||
| WBPhenotype:0001414 | Person_evidence | WBPerson7743 | ||||||
| Curator_confirmed | WBPerson712 | |||||||
| Remark | Comments to the National Bioresource Project of Japan: Dr. D. Greenstein: Male: defects in mating behavior | Person_evidence | WBPerson7743 | |||||
| Curator_confirmed | WBPerson712 | |||||||
| Laboratory_evidence | FX | |||||||
| Remark | 4863/4864-5168/5169 (305 bp deletion) | |||||||
| This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
| Method | NBP_knockout_allele |
