WormBase Tree Display for Variation: WBVar00251205
expand all nodes | collapse all nodes | view schema
WBVar00251205 | Name | Public_name | tm2303 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | T07G12.11a.1:c.625_838del | |||||||
CE21166:p.Cys209MetfsTer51 | ||||||||
CE45931:p.Cys209MetfsTer51 | ||||||||
T07G12.11b.1:c.625_838del | ||||||||
HGVSg | CHROMOSOME_IV:g.10559408_10559778del | |||||||
Sequence_details | SMap | S_parent | Sequence | T07G12 | ||||
Flanking_sequences | tatgaattattcgaagattcctccaatgac | atgaaaccatggtgccacactccgaaccaa | ||||||
Mapping_target | T07G12 | |||||||
Source_location | 7 | CHROMOSOME_IV | 10559407 | 10559779 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm2303_external | |||||||
tm2303_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00004048 | |||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 2303 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00011601 | ||||||
Transcript | T07G12.11a.1 (11) | |||||||
T07G12.11b.1 (11) | ||||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | IV | ||||||
Description | Phenotype | WBPhenotype:0000052 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson48 | |||||||
Remark | Comment from Dr. A. Dernburg to the National Bioresource Project of Japan: homozygous worms are viable and healthy, but produce many (~70%) inviable progeny. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson48 | |||||||
Penetrance | Incomplete | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson48 | |||||||
WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson48 | |||||||
Remark | Classified as lethal OR sterile by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson48 | |||||||
Laboratory_evidence | FX | |||||||
WBPhenotype:0000206 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson48 | |||||||
Remark | Comment from Dr. A. Dernburg to the National Bioresource Project of Japan: homozygous worms are viable and healthy, but produce many (~70%) inviable progeny due to missegregation of chromosome I and IV during meiosis. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson48 | |||||||
WBPhenotype:0000688 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson48 | |||||||
Remark | Classified as lethal OR sterile by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson48 | |||||||
Laboratory_evidence | FX | |||||||
WBPhenotype:0001175 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson48 | |||||||
Remark | Comment from Dr. A. Dernburg to the National Bioresource Project of Japan: Weak Him phenotype (6.7% males), which is an indirect consequence of autosomal defects during meiosis. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson48 | |||||||
Reference | WBPaper00061173 | |||||||
Remark | 30975/30976-31346/31347 (371 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Variation stub/paper connection generated from the May 2021 NN VFP dataset. | ||||||||
Created by WBPerson51134 from the NN_VFP_triage_pipeline | ||||||||
Method | NBP_knockout_allele |