WormBase Tree Display for Variation: WBVar00250997

WBVar00250997 Name: Public_name: tm2051
    Other_name: F41G3.12.1:c.3854-70_3979+108del
    HGVSg: CHROMOSOME_II:g.6762049_6762471del
  Sequence_details: SMap: S_parent: Sequence: F41G3
    Flanking_sequences: tttaagagacgtgacaattctaaatcagat ttatatttgaaattctcactacacttcaac
    Mapping_target: F41G3
    Source_location: 7 CHROMOSOME_II 6762048 6762472 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm2051_external
      tm2051_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 2051
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00018304
    Transcript: F41G3.12.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: F41G3.12.1:c.3854-70_3979+108del
        Intron_number: 26-28/30
        Exon_number: 27-28/31
  Isolation: Mutagen: TMP/UV
  Genetics: Map: II
  Description: Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000642 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the National Bioresource Project of Japan from Dr. Y-C. Wu: no hyperactive defect. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: YW
      WBPhenotype:0000643 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the National Bioresource Project of Japan from Dr. Y-C. Wu: no locomotion defect. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: YW
  Remark: 22164/22165-22587/22588 (423 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele