WormBase Tree Display for Variation: WBVar00250787
expand all nodes | collapse all nodes | view schema
WBVar00250787 | Name | Public_name | tm1823 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | F36H2.1b.1:c.745_1067-102delinsTTGAATTTACCGC | |||||||
F36H2.1c.1:c.790_1112-102delinsTTGAATTTACCGC | ||||||||
F36H2.1d.1:c.754_1076-102delinsTTGAATTTACCGC | ||||||||
F36H2.1a.1:c.799_1121-102delinsTTGAATTTACCGC | ||||||||
HGVSg | CHROMOSOME_I:g.9239348_9240064delinsGCGGTAAATTCAA | |||||||
Sequence_details | SMap | S_parent | Sequence | F36H2 | ||||
Flanking_sequences | tttcttttttttagcggtaaattcaaattg | atcagcttcatttggaagatgttgggtatg | ||||||
Mapping_target | F36H2 | |||||||
Source_location | 7 | CHROMOSOME_I | 9239347 | 9240065 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Insertion | GCGGTAAATTCAA | ||||||
Deletion | ||||||||
PCR_product | tm1823_external | |||||||
tm1823_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 1823 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00009498 | ||||||
Transcript | F36H2.1c.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | F36H2.1c.1:c.790_1112-102delinsTTGAATTTACCGC | |||||||
cDNA_position | 862-? | |||||||
CDS_position | 790-? | |||||||
Protein_position | 264-? | |||||||
Intron_number | 4-5/11 | |||||||
Exon_number | 4-5/12 | |||||||
F36H2.1b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F36H2.1b.1:c.745_1067-102delinsTTGAATTTACCGC | |||||||
cDNA_position | 778-? | |||||||
CDS_position | 745-? | |||||||
Protein_position | 249-? | |||||||
Intron_number | 5-6/12 | |||||||
Exon_number | 5-6/13 | |||||||
F36H2.1a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F36H2.1a.1:c.799_1121-102delinsTTGAATTTACCGC | |||||||
cDNA_position | 871-? | |||||||
CDS_position | 799-? | |||||||
Protein_position | 267-? | |||||||
Intron_number | 4-5/11 | |||||||
Exon_number | 4-5/12 | |||||||
F36H2.1d.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F36H2.1d.1:c.754_1076-102delinsTTGAATTTACCGC | |||||||
cDNA_position | 789-? | |||||||
CDS_position | 754-? | |||||||
Protein_position | 252-? | |||||||
Intron_number | 5-6/12 | |||||||
Exon_number | 5-6/13 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | I | ||||||
Description | Phenotype | WBPhenotype:0000032 | Paper_evidence | WBPaper00032450 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Mutants are sick (data not shown). | Paper_evidence | WBPaper00032450 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as lethal or sterile by the National Bioresource Project of Japan. Comment to the NBP from Dr. M. Han: Let and Ste. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
MH | ||||||||
WBPhenotype:0000230 | Paper_evidence | WBPaper00032450 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Mutants have withered tails (data not shown). | Paper_evidence | WBPaper00032450 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00032450 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Mutants become uncoordinated (data not shown). | Paper_evidence | WBPaper00032450 | |||||
Curator_confirmed | WBPerson712 | |||||||
Homozygous adults mutant for each condensin II subunit exhibited abnormal connections between nuclei in late-dividing cell types such as ventral nerve cord, gut, and germline, which likely reflect failed mitotic chromosome segregation. | Paper_evidence | WBPaper00032450 | ||||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000688 | Paper_evidence | WBPaper00032450 | ||||||
Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as lethal or sterile by the National Bioresource Project of Japan. Comment to the NBP from Dr. M. Han: Let and Ste. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
MH | ||||||||
Mutants become sterile adults (data not shown). | Paper_evidence | WBPaper00032450 | ||||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000697 | Paper_evidence | WBPaper00032450 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Mutants display protruding vulvae (data not shown). | Paper_evidence | WBPaper00032450 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000823 | Paper_evidence | WBPaper00032450 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | The germline was extremely underproliferated and contained only a small patch of abnormal nuclei. | Paper_evidence | WBPaper00032450 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001378 | Paper_evidence | WBPaper00032450 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Homozygous adults mutant for each condensin II subunit exhibited abnormal connections between nuclei in late-dividing cell types such as ventral nerve cord, gut, and germline, which likely reflect failed mitotic chromosome segregation. | Paper_evidence | WBPaper00032450 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00032450 | |||||||
Remark | 3802/3803-GCGGTAAATTCAA-4519/4520 (717 bp deletion + 13 bp insertion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |