WormBase Tree Display for Variation: WBVar00250677

WBVar00250677 Name: Public_name: tm1706
    Other_name (11)
    HGVSg: CHROMOSOME_I:g.12526224_12526772delinsCC
  Sequence_details: SMap: S_parent: Sequence: K11D2
    Flanking_sequences: atgtcaatattgccccaaaaaagtcaatag ggccgctcattccgtcaacgttcgcaacaa
    Mapping_target: K11D2
    Source_location: 7 CHROMOSOME_I 12526223 12526774 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: CCC
      Deletion
    PCR_product: tm1706_external
      tm1706_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 1706
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00010770
    Transcript: K11D2.4d.1 (11)
      K11D2.4e.1 (11)
      K11D2.4c.1 (11)
      K11D2.4a.1 (11)
      K11D2.4b.1 (11)
      K11D2.4a.2 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description: Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National BioResource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000643 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. W. Schafer to the National Bioresource Project of Japan: locomotion grossly normal. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. W. Schafer to the National Bioresource Project of Japan: fertile. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 25569/25570-CCC-26119/26120 (550 bp deletion + 3 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele