WormBase Tree Display for Variation: WBVar00250586

WBVar00250586 Name: Public_name: tm1605
    Other_name (14)
    HGVSg: CHROMOSOME_IV:g.10338036_10338686del
  Sequence_details: SMap: S_parent: Sequence: K11E8
    Flanking_sequences: ggtgttggtcctcatcccagaatggtgggt caaaaaatacttcagaccttcatgtctcta
    Mapping_target: K11E8
    Source_location: 7 CHROMOSOME_IV 10338035 10338687 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm1605_external
      tm1605_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 1605
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00006779
    Transcript (14)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: IV
  Description: Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National BioResource Project of Japan. Originally classified as lethal OR sterile by the NBP. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 15890/15891-16541/16542 (651 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele