WormBase Tree Display for Variation: WBVar00250571

WBVar00250571 Name: Public_name: tm1586
    Other_name: ZK1307.8.2:c.101-38_589del
      ZK1307.8.3:c.101-38_589del
      ZK1307.8.1:c.101-38_589del
    HGVSg: CHROMOSOME_II:g.9624844_9625370del
  Sequence_details: SMap: S_parent: Sequence: CHROMOSOME_II
    Flanking_sequences: tttcaagataaaaatccctattggctccac gaaagttgcaagatgaacatagaaatcaat
    Mapping_target: CHROMOSOME_II
    Source_location: 7 CHROMOSOME_II 9624843 9625371 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm1586_external
      tm1586_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 1586
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00014249
    Transcript: ZK1307.8.1 VEP_consequence: splice_acceptor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: ZK1307.8.1:c.101-38_589del
        cDNA_position: ?-591
        CDS_position: ?-589
        Protein_position: ?-197
        Intron_number: 2/5
        Exon_number: 3/6
      ZK1307.8.3 VEP_consequence: splice_acceptor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: ZK1307.8.3:c.101-38_589del
        cDNA_position: ?-615
        CDS_position: ?-589
        Protein_position: ?-197
        Intron_number: 2/5
        Exon_number: 3/6
      ZK1307.8.2 VEP_consequence: splice_acceptor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: ZK1307.8.2:c.101-38_589del
        cDNA_position: ?-591
        CDS_position: ?-589
        Protein_position: ?-197
        Intron_number: 2/5
        Exon_number: 3/6
  Isolation: Mutagen: TMP/UV
  Genetics: Map: II
  Description: Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000648 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. M. Barr to the National Bioresource Project of Japan: male mating behavior normal. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000673 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. M. Barr to the National Bioresource Project of Japan: brood size normal. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0001068 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. M. Barr to the National Bioresource Project of Japan: 5-HT-induced egg laying normal. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: [T15H9] 21923/21924-[ZK1307] 260/261 (528 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
    Old Mapping_target T15H9 updated based on the VEP analysis pipeline to CHROMOSOME_II.
  Method: NBP_knockout_allele