WormBase Tree Display for Variation: WBVar00250459

WBVar00250459 Name: Public_name: tm1466
    Other_name: ZK849.2c.1:c.653_943delinsAA
      CE40679:p.Ile240LysfsTer16
      CE40678:p.Ile242LysfsTer16
      ZK849.2a.1:c.725_1015delinsAA
      CE41095:p.Ile218LysfsTer16
      ZK849.2b.1:c.719_1009delinsAA
    HGVSg: CHROMOSOME_I:g.14186738_14187498delinsTT
  Sequence_details: SMap: S_parent: Sequence: ZK849
    Flanking_sequences: cctcctgatgcttgacagtccgaagatcgt tttcggcttccagctggttccagagcctgt
    Mapping_target: ZK849
    Source_location: 7 CHROMOSOME_I 14186737 14187499 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: TT
      Deletion
    PCR_product: tm1466_external
      tm1466_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 1466
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00014101
    Transcript: ZK849.2c.1 (11)
      ZK849.2a.1 (11)
      ZK849.2b.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description: Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000415 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. M. Driscoll to the National Bioresoure Project of Japan: no effect on necrotic cell death. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000643 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. D.M. Miller to the National Bioresource Project of Japan: no locomotory perturbations. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0001321 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. K. Shen to the National Bioresource Project of Japan: normal DA presynaptic puncta. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 6737/6738-TT-7498/7499 (761 bp deletion + 2 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele