WormBase Tree Display for Variation: WBVar00250355
expand all nodes | collapse all nodes | view schema
WBVar00250355 | Name | Public_name | tm1361 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | W09B6.3a.1:c.535-147_679del | |||||||
HGVSg | CHROMOSOME_II:g.1124893_1125184del | |||||||
Sequence_details | SMap | S_parent | Sequence | W09B6 | ||||
Flanking_sequences | ttttcgttcaaaatatcagttttaaacctg | tcatcacaaaaattatgaaaaatcatttta | ||||||
Mapping_target | W09B6 | |||||||
Source_location | 7 | CHROMOSOME_II | 1124892 | 1125185 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product (2) | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00040457 | |||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 1361 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00021103 | ||||||
Transcript | W09B6.3a.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | W09B6.3a.1:c.535-147_679del | |||||||
cDNA_position | ?-681 | |||||||
CDS_position | ?-679 | |||||||
Protein_position | ?-227 | |||||||
Intron_number | 5/12 | |||||||
Exon_number | 6/13 | |||||||
W09B6.3b.1 | VEP_consequence | coding_sequence_variant,5_prime_UTR_variant | ||||||
VEP_impact | MODIFIER | |||||||
cDNA_position | ?-121 | |||||||
CDS_position | ?-121 | |||||||
Protein_position | ?-41 | |||||||
Exon_number | 1/7 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | II | ||||||
Description | Phenotype | WBPhenotype:0000688 | Paper_evidence | WBPaper00038150 | ||||
Curator_confirmed | WBPerson712 | |||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00038150 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000983 | Paper_evidence | WBPaper00044616 | ||||||
Curator_confirmed | WBPerson602 | |||||||
Remark | fer-3(hc3) fails to complement the Fer and Eri phenotypes of eri-3(tm1361). | Paper_evidence | WBPaper00044616 | |||||
Curator_confirmed | WBPerson602 | |||||||
WBPhenotype:0001175 | Paper_evidence | WBPaper00027057 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | eri mutant strains exhibit an increase in the frequency of X chromosome nondisjunction resulting in a high incidence of males (Him) phenotype. | Paper_evidence | WBPaper00027057 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001258 | Paper_evidence | WBPaper00038150 | ||||||
WBPaper00027057 | ||||||||
WBPaper00044616 | ||||||||
Curator_confirmed | WBPerson712 | |||||||
WBPerson602 | ||||||||
Remark | Tissue and RNA-specific enhancement. Exhibits an Eri phenotype that has an upper bound of 95% confidence interval at least 100% penetrant with a ~10% standard deviation in the pharynx. | Paper_evidence | WBPaper00038150 | |||||
Curator_confirmed | WBPerson712 | |||||||
in wild-type animals, RNAi targeting unc-73 results in a low-penetrance-uncoordinated (Unc) phenotype, such that only about 4% of the F1 progeny of animals exposed to unc-73(RNAi) exhibit the characteristic deformed, poorly motile phenotype. In contrast, these mutants exhibited enhanced RNAi against unc-73. RNAi targeting lin-1, dpy-13, hmr-1, and a neuronal unc-47::gfp was also enhanced in these mutants. | Paper_evidence | WBPaper00027057 | ||||||
Curator_confirmed | WBPerson712 | |||||||
fer-3(hc3) fails to complement the Fer and Eri phenotypes of eri-3(tm1361). | Paper_evidence | WBPaper00044616 | ||||||
Curator_confirmed | WBPerson602 | |||||||
WBPhenotype:0001369 | Paper_evidence | WBPaper00027057 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | The interaction between DCR-1 and ERI-1 was abolished in eri-3 mutant extracts. | Paper_evidence | WBPaper00027057 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001595 | Paper_evidence | WBPaper00027057 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | eri mutant strains exhibit spontaneous silencing of simple transgenic arrays in the soma. | Paper_evidence | WBPaper00027057 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001683 | Paper_evidence | WBPaper00027057 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | eri mutant strains exhibit a sperm-defective sterile phenotype at 25 degC. | Paper_evidence | WBPaper00027057 | |||||
Curator_confirmed | WBPerson712 | |||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00027057 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0002147 | Paper_evidence | WBPaper00027057 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Accumulation of several small-RNA species, including small RNAs corresponding to the somatically expressed gene K02E2.6, the X cluster, and the tncRNAs species required ERI-3 proteins. The eri mutant strains exhibited defects in the accumulation of these small-RNA species even when maintained at the permissive temperature. A 5-fold upregulation of K02E2.6 mRNA levels was observed. | Paper_evidence | WBPaper00027057 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National BioResource Project of Japan. Dr. C. Mello, Cell 124, 343-354 (2006). Comment from Dr. C. Bargmann to the National Bioresource Project of Japan: viable. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000688 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. C. Bargmann to the National Bioresource Project of Japan: fertile at 20 C | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0002146 | Paper_evidence | WBPaper00027057 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | The accumulation of at least eight small RNAs corresponding to germline-expressed genes, including T01A4.3, did not appear to require this gene. | Paper_evidence | WBPaper00027057 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00038150 | |||||||
WBPaper00027057 | ||||||||
WBPaper00044616 | ||||||||
Remark | 2085/2086-2377/2378 (292 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |